w10.0.13 | c1.0.0.2
PROD | u7.5.14
Header Image


print content
increase font
decrease font

rRT-PCR Primers & Probes for nCoV Coronavirus

Primers and probes recommended by the CDC & WHO

Eurofins Genomics can provide the primer and probe sequences recommended by the CDC and the WHO to researchers working on the coronavirus.

The sequences were publically provided by the CDC here and the WHO here. Researchers can order these primers and probes to create a panel in their lab, following the panel instructions from the CDC.

These materials are provided for research purposes only.

CDC Approved Sequences*

Name Description Sequence (5' -> 3') Label

Working Conc.


Forward Primer


Reverse Primer



5 µM

Forward Primer


Reverse Primer



5 µM

Forward Primer


Reverse Primer


2019-nCoV_N3 Probe

5 µM

RNAse P 
Forward Primer


RNAse P 
Reverse Primer



5 µM


>> Order Now

WHO Approved Sequences


Name Sequence (5' -> 3')



use 800 nM per reaction
will not detect SARS-CoVuse
100 nM per reaction
and mix with P1
will detect 2019-nCoV, SARS-CoV
and bat-SARS-related CoVsuse
100 nM per reaction and mix with P2
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction
  E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA Use 400 nM per reaction



We recommend to use the qPCR Assay order page to order the optimised and validated primer and probe sequences.

To order all recommended RdRP gene primers and probes, please use our Dual Labelled Probe and qPCR Primer order page. 


  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].


In order to prevent any cross-contamination of primers and probes with control plasmids, our standard procedure is to spatially separated our production of oligos and genes/plasmisds by separate rooms and  air systems!


*Eurofins Genomics does not claim that these materials are in any way endorsed or validated by the CDC.

Scroll to top ^^