NGSgrade 2nd PCR Oligos
progress bar
progress bar

Frequently asked questions
Contact us
Subscribe to newsletter
w10.0.14 | c2.0.0.22
PROD | u7.5.14
  Quick Order  0
Ecom-Admin
  • Markets
  • RUO Products
  • Company
  • Contact
  • EN
  • Oligonucleotide Synthesis
  • Gene Synthesis & Molecular Biology
  • Sanger Sequencing
  • Next Generation Sequencing
  • Genotyping & Gene Expression

Further Information:

>> EVOcard

>> Product FAQs

>> SALE %

Application Oligos

  • qPCR Probes
  • PCR Primer
  • SeqPrimer
  • Cloning Oligos
  • NGSgrade Oligos
>> Show more

Custom Oligos

  • Custom DNA Oligos
  • Large Scale Oligos
  • Custom RNA Oligos
  • Special Requests
>> Show more

Oligo Tools

  • Oligo Analysis Tool
  • Primer Design Tools
  • qPCR Assay Design Tools
  • siRNA Design Tool
>> Show more

Benefit from more than 25 years of experience in oligonucleotide synthesis!

>> Show all products

Gene Synthesis

  • Standard Genes
  • Express Gene
  • Gene Synthesis Project
  • GENEius
>> Show more

GeneStrands

  • GeneStrands
  • Express GeneStrands

Molecular Biology Services

  • Plasmid Preparation
  • CRISPR/Cas9
>> Show more

Optimise your research and save time with high quality gene synthesis and molecular biology services.

>> Show all products

Sequencing Services

  • Mix2Seq Service
  • TubeSeq Services
  • PlateSeq Service
  • Direct Colony Sequencing
  • Whole Plasmid Sequencing
>> Show more

Prepaid Products

  • Mix2Seq Kits
  • Barcode Labels, Kit & Coupons
  • PlateSeq Kits
  • PlateSeq Kit Colony
>> Show more

Additional Services

  • Free Barcode Labels
  • Sequencing Accessories
  • Sequencing Primers
  • Sample Shipment
>> Show more

Hiqh quality Sanger sequencing with highest flexibility for every sample type.

>> Show all products

Top 5 Products

  • INVIEW Resequencing
  • INVIEW Microbiome
  • INVIEW Transcriptome
  • INVIEW Metagenome
  • NGSelect Amplicon
>> Show more

Spotlight

  • INVIEW Exome
  • INVIEW Virus
  • INVIEW Plasmid Verification
  • INVIEW CRISPR Check
  • NGS Prepaid Coupons
>> Show more

Special Applications

  • Genome Sequencing
  • ARTIC SARS-CoV 2 RNA-Seq
  • Oncology Solutions
  • Oxford Nanopore (ONT)
>> Show more

NGS from experts - ISO-certified, fully automated and easy to order online.

>> Show all products

Applied Genomic Services

  • DNA Barcoding
  • Cell Line Authentication
  • Mycoplasmacheck
  • Fragment Length Analysis
>> Show more

Genotyping services

  • SNP Genotyping
  • Copy Number Variation
  • Mikrosatellites/ STR/FLA/ IDAA
>> Show more

Gene Expression Services

  • Transcriptome analysis
  • Expression Arrays
  • Target Gene Expression
>> Show more

Cell line authentication, Mycoplasmacheck, Fragment length analysis & tailored projects.

>> Show all products
  • Pharma / Biotech
  • Agrigenomics
  • Consumer Genomics
  • Food & Environment
  • Diagnostic Kit Producer
  • Research / Biotech

Further Information:

>> Quality

>> Events

Synthesis Products

  • Large Scale Oligos
  • Special Oligo Requests
  • Gene Synthesis
  • GeneStrands
  • Plasmid Preparation

Sequencing Services

  • Primer Walking under GLP
  • Sanger Sequencing Projects
  • Amplicon Sequencing
  • Exome Sequencing
  • Transcriptome Sequencing

Favorite Content

  • NGS – Disease Diagnostics
  • Cancer Ecology
  • Personalised Cancer Therapy
  • Revolutionising human-like-protein production
  • The Microbiome Of Cancer
  • All about biomarker discovery

Our genomics solutions support you along your drug development chain of small and large molecules and in precision medicine.

>> Show all products

Plant Breeder

  • DNA marker discovery
  • Marker-assisted selection
  • GRAS-Di®
  • Microbiome and metagenomics

Animal Breeder

  • DNA Marker discovery
  • Pathogen screening
  • Parentage testing
  • Genomic selection
  • Marker-assisted selection

Favorite Content

  • Microarrays Accelerate Blue Biotechnology
  • How To Do NGS 50% Faster

Benefit from our range of tailored, high throughput genotyping solutions to help you achieve your goals faster, for less.

>> Show all products

Sequencing Services

  • Genotyping
  • Epigenome Profiling
  • Microbiome Analysis
  • Shotgun Sequencing
  • Whole Genome Sequencing

Additional Services

  • Sample Collection Kits
  • Shipping
  • DNA Extraction
  • Laboratory Service
  • Biobanking

Favorite Content

  • Population Genetics
  • The End of Gene Doping
  • Home Genomics Testing
  • IVDR Compliance

Welcome to your full-service laboratory. Benefit from our end-to end solutions for sample collection kit logistics and genomic solutions.

>> Show all products

Food Testing

  • Food Authenticity
  • Meat Traceability
  • Pathogen Traceability
  • Cannabis and Hemp Testing

Environmental Testing

  • Non-targeted detection of organisms / species
  • Targeted detection of organisms / species
  • eDNA Tracker

Favorite Content

  • Determine the Source of Meat
  • Pine Nuts – Why Testing For Edibility Matters
  • Environmental Microbiology In Action
  • From Waste Gas To Biofuel

DNA-based solutions to improve and support your analysis, monitoring and traceability across your value chain.

>> Show all products

Synthesis Products

  • Large Scale Oligos
  • Special Requests in Tubes
  • Special Requests in Plates

Quality Assurance

  • GLP
  • ISO 17025
  • ISO 13485

Favorite Content

  • Oligonucleotides For Diagnostics
  • The Future of RNA Applications

Our scalable and high-quality oligonucleotides synthesis offer makes us an ideal partner for your industry applications.

>> Show all products

Favorite Services

  • Custom DNA Oligos
  • TubeSeq Services Sanger
  • INVIEW Microbiome NGS
  • NGS Services
  • GeneStrands

Express Services

  • TubeSeq NightXpress
  • Mix2Seq NightXpress
  • Express Genes
  • Express GeneStrands

Favorite Content

  • Eurofins Genomics Goes Green
  • GENEius – Codon Usage Optimisation
  • 5 tips to speed up your qPCR

For your research project in academic, governmental and industrial environment we have the right genomic service.

>> Show all products

Corporate Information

  • About us
  • Career
  • Events
  • Press Releases
  • Collaborations
  • Blog
  • Newsletter
  • Quality Assurance
  • Lab closure times

Help

  • Video Tutorials
  • Ordering
  • Payment
  • Shipping & Delivery
  • Downloads
  • Data & Privacy
  • Material and Methods

Contact us

Eurofins Genomics
Germany GmbH
Anzinger Str. 7a
85560 Ebersberg
Germany

  • phone +49 7531 816068
  • e-mail support

Get in touch with us!

You need support or advice with your order? You don't find the perfect product or you like to get consultation regarding your results?

>> Get in touch

Find your product

Find your product

  • Sequencing Primer
  • PCR Primer
  • Mycoplasmacheck
  • SALE %
  • TubeSeq

Login to Eurofins

Please login with your email address and password!

>> Login

New at Eurofins Genomics?

Register a new account at Eurofins Genomics!

>> Register
Impersonating: Max Mustermann

Administration

  • Ecom Admin
  • Stop Impersonating

Welcome

Julian Schlossmacher

Login / Register

 
Email
Password:
Forgot password?
Create Account
No SSL
>> Logout >> My profile

Contact

Dr. Melvin Siliakus

+31 629 39 25 66 >> Send message

Account

  • Overview
  • Orders
  • Quotes
  • EVOcards
  • Preferences
  • DropBoxes
  • Sanger Kits & Barcodes
  • NGS Barcodes & Coupons
  • Sanger Samples & Primers

Language

model-logo

New Website Navigation explained

>> Close
6

Last added items

0 Item(s)

Go to Cart

>> Go to cart X
 

Quick Order

X

Industrial-grade Products & Services

What are industrial-grade products? <<click here >>

Oligonucleotide Synthesis

  • Request for Oligos in Tubes
  • Request for Oligos in Plates
  • Large Scale Oligos

Gene Synthesis & Molecular Biology

  • Gene Synthesis
  • GeneStrands
  • Express GeneStrands
  • Plasmid Preparation
  • Site Directed Mutagenesis
  • Cloning Service

Sanger Sequencing

  • TubeSeq Ultimate
  • Primer Walking
  • Primer Walking under GLP
  • Re-Sequencing Projects
  • Re-Sequencing under GLP
  • 16S / ITS Sequencing
  • TOPO-TA Cloning
  • Shipping Options
  • Barcode Labels & Coupons

Next Generation Sequencing

  • Genome (Re-)Sequencing
  • Transcriptome Sequencing
  • Microbiome profiling
  • Exome Sequencing
  • Oncoprofiling
  • Liquid Biopsy Sample Sequencing
  • Ready-to-Load
  • Virus Sequencing
  • SARS-CoV-2 Sequencing
  • Plasmid Sequencing
  • Amplicon Sequencing

Genotyping & Genexpression

  • Cell Line Authentication
  • Fragment Length Analysis
  • Mycoplasmacheck Barcodes
  • Cell Line Barcodes

Oligonucleotide Synthesis

Primers & Probes for qPCR Applications

  • PCR Primer in Tubes
  • PCR Primer NightXpress
  • PCR Primer in Plates
  • LocNA Primer
  • Dual Labeled Probes
  • MGB Probes
  • LocNA Probe
  • Molecular Beacons
  • LightCycler Probes
  • Probe based qPCR Assay

Oligos for Next Generation Sequencing

  • NGSgrade Oligos in Tubes
  • NGSgrade Oligos in Plates
  • NGS Adaptor Lig. Oligos
  • NGS 2nd PCR Oligos
  • NGS UDI Primer Sets

Primers for Sanger Sequencing

  • SeqPrimer in Tubes
  • SeqPrimer NightXpress
  • SeqPrimer in Plates
  • Standard Primer

Oligos for Cloning Applications

  • Cloning Oligos
  • EXTREmer Oligos

Custom Oligos

  • Custom DNA Oligos in Tube
  • SaltFree Oligo NightXpress
  • Custom DNA Oligos in Plates
  • Custom RNA Oligos
  • O-Methyl-RNA / Chimerics
  • RNA qPCR Probes
  • siMAX siRNA
  • Special Oligos in Tubes

Oligo Tools

  • Oligo Analysis Tool
  • PCR Primer Design
  • qPCR Assay Design
  • SeqPrimer Design
  • siMAX siRNA Design

Gene Synthesis & Molecular Biology

Synthetic genes

  • Gene Synthesis
  • Combinatorial libraries
  • Gene Synthesis Projects

GeneStrands

  • GeneStrands
  • Express GeneStrands

Molecular Biology Services

  • Plasmid Preparation
  • Site Directed Mutagenesis
  • DNA Cloning Service

Sanger Sequencing

Sanger Sequencing Services

  • ++NEW++ TubeSeq NightXpress
  • ++NEW++ TubeSeq Supreme
  • PlateSeq Service
  • SupremeRun 96
  • Direct Colony Sequencing
  • Ready2Load Plate
  • Ready2Load Tube
  • Whole Plasmid Sequencing Tubes
  • Whole Plasmid Sequencing Plate

Prepaid Products for Sanger Sequencing

  • ++NEW++ TubeSeq NXP Kit
  • Prepaid Barcodes & Coupons
  • Mix2Seq Kits
  • PlateSeq Kits
  • SupremeRun 96 Barcodes
  • LightRun Barcodes

Additional Services

  • Tube & Plate Barcode Labels
  • Sequencing Accessories
  • Sample Shipment
  • Sequencing Primer Design

Next Generation Sequencing

Genome Sequencing

  • INVIEW Resequencing
  • NGSelect DNA
  • Whole Genome Sequencing

Transcriptome Sequencing

  • INVIEW Transcriptome
  • NGSelect RNA
  • Industrial grade RNA-Seq

Metagenome / Microbiome

  • INVIEW Microbiome
  • INVIEW Metagenome

Exome Sequencing & Oncology Solutions

  • INVIEW Human Exome
  • Liquid Biopsy Samples
  • INVIEW Oncoprofiling

CRISPR & Prepaid NGS Coupons

  • INVIEW CRISPR Check
  • Redeem NGS Coupons
  • Order NGS Coupons

VIRUS

  • INVIEW Virus
  • SARS-CoV-2 (Corona virus)

Plasmid Sequencing

  • INVIEW Plasmid Verification

Amplicon sequencing & Ready-to-Load

  • NGSelect Amplicon
  • NGSelect Ready-to-Load

Additional Services

  • NGS Barcodes & UPS labels
  • NGS Additional Services
  • Sample Submission Guidelines
  • Prepaid NGS Coupons
  • Replacement samples
  • Request for Information

Genotyping & Gene Expression

Mycoplasmacheck

  • Mycoplasmacheck Barcodes
  • Mycoplasmacheck results

CLA & FLA

  • Cell line authentication Service (CLA)
  • Fragment length Analysis (FLA)
  • Cell line authentication barcodes

Others

  • Genotyping request form

EVOcard

Order / Refill EVOcard

Login / Register

 
Email
Password:
Forgot password?
Create Account
No SSL

 

  • Order Menu

    EVOcards

    • Order / Refill EVOcard

    Oligonucleotides & siRNA

    • (q)PCR Primer in Tubes
    • (q)PCR Primer in Plates
    • (q)PCR Primer NightXpress
    • SeqPrimer in Tubes
    • SeqPrimer in Plates
    • SeqPrimer NightXpress
    • Custom DNA Oligos in Tubes
    • Custom DNA Oligos in Plates
    • SaltFree Oligo NightXpress
    • NGSgrade Oligos in Tubes
    • Standard Primer
    • Standard Primer NightXpress
    • LocNA Primer
    • LocNA Probes
    • Dual Labeled Probes
    • MGB Probes
    • Probe based qPCR Assay
    • Cloning Oligos in Tubes
    • EXTREmer Oligos
    • Nano-Scale Plate Oligos
    • NGS UDI Primer Sets
    • Custom RNA Oligos
    • RNA qPCR Probes
    • siMAX siRNA
    • Large Scale Oligos
    • Special Oligo Requests
    • More...

    Custom DNA Sequencing

    • Mix2Seq Kits
    • LightRun Barcodes
    • Sequencing Primers
    • TubeSeq Service
    • SupremeRun Tube
    • Tube & Plate Barcode Labels
    • TubeSeq Labels & Coupons
    • SupremeRun Barcodes
    • Sequencing Accessories
    • PlateSeq Kits
    • SupremeRun 96
    • Primer Walking
    • PlateSeq Service
    • SupremeRun | Multiprimer
    • Sequencing Projects
    • Direct Colony Sequencing
    • Ready2Load Plate
    • More...

    Next Generation Sequencing

    • INVIEW Microbiome 3.0
    • NGSelect DNA
    • Barcode & UPS Labels
    • INVIEW Transcriptome
    • NGSelect RNA
    • Replacement samples
    • INVIEW Resequencing
    • NGSelect Amplicon
    • Sample Submission
    • INVIEW Human Exome
    • Redeem NGS Coupons
    • Request for Information
    • INVIEW CRISPR Check
    • SARS-CoV-2 RNA-Seq
    • More...
    • INVIEW Virus

    Gene Synthesis & Molecular Biology

    • New gene wizard
    • Plasmid Preparation
    • GeneStrands
    • Express Genes
    • DNA Cloning Service
    • Express GeneStrands
    • Gene Synthesis Project
    • Site Directed Mutagenesis
    • Combinatorial libraries
    • Synthetic genes
    • Corona Control Plasmids

    Genotyping & Gene Expression

    • Mycoplasmacheck
    • Cell Line Authentication 2.0
    • Fragment Length Analysis
    • Request for Information

0 Item(s)

Go to Cart

  • Other Languages
  • DNA & RNA
    Oligonucleotides
    • >

      Optimised Application Oligos

    • >
      qPCR Probes
    • >
      PCR Primers
    • >
      SeqPrimer
    • >
      Cloning Oligo
    • >
      EXTREmers
    • >
      NGSgrade Oligos
    • >

      Custom DNA & RNA Oligos

    • >
      Custom DNA Oligos
    • >
      Large Scale Oligos
    • >
      Custom RNA Oligos
    • >
      siMAX siRNA
    • >
      Special Requests
    • >

      Oligo Tools

    • >
      Oligo Analysis Tool
    • >
      Primer Design Tools
    • >
      qPCR Assay Design Tools
    • >
      siRNA Design Tool
  • Custom DNA Sequencing
    • >

      Eurofins Services

    • >
      Mix2Seq
    • >
      Mix2Seq Kits
    • >
      TubeSeq Services
    • >
      TubeSeq Labels, Kits & Coupons
    • >
      PlateSeq Service
    • >
      PlateSeq Kits
    • >
      Ready2Load Service
    • >
      Direct Colony Sequencing
    • >
      Whole Plasmid Sequencing
    • >
      Sequencing Projects
    • >

      GATC Services

    • >
      LightRun Tube
    • >
      LightRun Plate
    • >
      LightRun Barcodes
    • >
      SupremeRun Plate
    • >
      SupremeRun Barcodes
    • >
      SupremeRun Tube Info
    • >

      Additional Services

    • >
      Tube & Plate Barcode Labels
    • >
      Sequencing Primers
    • >
      Sequencing Accessories
    • >
      Sample Shipment
    • >
      Free Sample Pick-Up
    • >
      Shipping Options
  • Next Generation Sequencing
    • >

      NGS Built For You

    • >
      INVIEW Microbiome
    • >
      INVIEW Transcriptome
    • >
      INVIEW Exome
    • >
      INVIEW Genome
    • >
      INVIEW Metagenome
    • >
      INVIEW CRISPR Check
    • >
      INVIEW Virus
    • >
      NGS prepaid solutions
    • >
      INVIEW Plasmid Verification
    • >

      NGS Build Your Own

    • >
      NGSelect DNA
    • >
      NGSelect RNA
    • >
      NGSelect Amplicons
    • >
      NGSelect Ready2Load
    • >

      Customised Solutions

    • >
      Oncology solutions
    • >

      Applications

    • >
      SARS-CoV 2 Genome Sequencing
    • >
      Artic SARS-CoV 2 RNA-Seq
  • Gene Synthesis / Molecular Biology
    • >

      Gene Synthesis

    • >
      Standard Genes
    • >
      Express Genes
    • >
      Complex Genes
    • >
      GeneStrands
    • >
      Express GeneStrands
    • >
      Combinatorial Libaries
    • >
      GENEius
      • >

        Molecular Biology Services

      • >
        Plasmid Preparation
      • >
        Site Directed Mutagenesis
      • >
        SureVector Service
      • >

        Applications

      • >
        CRISPR_Cas9
    • Genotyping & Gene Expression
      • >

        Service Platforms

      • >
        Illumina Array Platforms
      • >
        Affymetrix Array Platforms
      • >
        Fluidigm BioMark & EP1
      • >
        Roche LightCycler
      • >
        Sanger & NGS Sequencing
      • >

        Genotyping Services

      • >
        SNP Genotyping
      • >
        Microsatellites / STR / FLA / IDAA
      • >
        Sequencing Based Genotyping
      • >
        Genotyping by PCR
      • >
        Genome Wide Association
      • >
        Human Identification
      • >
        Copy Number Variation
      • >

        Gene Expression Services

      • >
        Transcriptome Analysis
      • >
        Expression Arrays
      • >
        Target Gene Expression
      • >
        miRNA / Small RNAs Analysis
      • >

        Applied Genomics Services

      • >
        Residual DNA Analysis
      • >
        DNA Barcoding
      • >
        Cell Line Authentication
      • >
        Mycoplasmacheck
     

    NGSgrade 2nd PCR Oligos

      Intro & Info

    The Amplicon 2nd PCR Oligos have been developed especially to allow pooling of samples for NGS on Illumina

    They are designed and validated by our in-house NextGen sequencing lab.

    How it works
    • You provide amplicons generated with NGS primers consisting of the target specific sequences and a universal adapter sequence
    • During library prep, Eurofins Genomics adds indexed sequencing adaptors necessary for sample discrimination

    How to order
    • Please download our Excel template first, which is specifically coded for designing your 2nd PCR primers
    • Each PCR product must harbor universal adaptors on both ends of the fragment
    • We are directly adding the required adaptor sequences to the target specific primer sequences you are uploading
    • For a correct design, you must provide those sequences in 5’ -3’ direction
    • You may provide in the upload form different forward and reverse primers in case you are targeting more than one region
    • Upload the filled Excel form and press "Next". Options for synthesis scales and delivery format are found in the next step
    • Check your uploaded sequences on the next step and press "Add to Cart"

    Adaptor sequences
    • Forward Primer Sequence: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    • Reverse Primer Sequence: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT

     
    • Select your entry format
    • Specify your oligos
     

    Entry Format

    XLS Icon Download our Excel template for uploading your NGS Oligos.
    Please read more details in above INTRO & INFO box by clicking on the arrow icon.
     
     
     
    Define your oligos by using our Excel template above. Upload your file and press "Next".
     
     
    Next
     
    Production Site
    • Europe
    • America
    • India
    • Japan
    Eurofins Genomics
    • Terms & Conditions
    • Sitemap
    • Imprint
    • Privacy
    • Licenses
    • Cookie Settings
    Contact
    General Customer Support
    phone +49 7531 816068
    Toll free phone number for
    Europe: 00800 200 100 20
    support-eu@genomics.eurofinseu.com

    Eurofins Genomics Europe Shared Services GmbH
    Anzinger Str. 7a
    85560 Ebersberg
    Germany

    /p>

    2023 - Eurofins Genomics

    VEGA Beta