Optimized synthesis process for high quality industrial grade oligonucleotides with superior performance in NGS applications. - Index Adaptor Primers for incorporation of molecular barcodes (UDIs, CDIs, UDI-UMIs)
- Primers for amplification and sequencing
- Target Capture Probes or blocking oligos
- Other molecular biological applications with low cross-contamination specifications
Specifications:- Typical cross contamination rate of 0.01% - 0.05%
- Available minimum quantities of 4 nmol, 10 nmol and 25 nmol
- DNA sequence length from 15 - 120 bases
- Quality is ensured by ESI-MS (electrospray ionization mass spectrometry)
- An online quality report, including the ESI-MS spectra, is provided online, free of charge
- Oligos are supplied in tubes either lyophilized or in liquid form at the selected concentration
- Selectable solvents are bidest water, TE buffer (10 mM Tris, 1 mM EDTA; pH=8) or Low EDTA Puffer (10 mM Tris, 0.1 mM EDTA pH = 8)
How to order: We recommend using our Excel templates which can be downloaded below, to upload your NGS oligos.
For NGS Oligos for MiSeq: - Please download our Excel template first, which is specifically coded for designing your 2nd PCR primers
- Each PCR product must harbor universal adaptors on both ends of the fragment
- We are directly adding the required adaptor sequences to the target specific primer sequences you are uploading
- For a correct design, you must provide those sequences in 5’ -3’ direction
- You may provide in the upload form different forward and reverse primers in case you are targeting more than one region
For NGS Oligos for NovaSeq: - Please download our Excel template first, which is specifically coded for designing your amplicon adaptor ligation oligos
- Provide your target specific primer sequences in 5’ -3’ direction for a correct design
- You may provide different forward and reverse primer sequences in case you are targeting more than one region
- A maximum of 192 oligos can be ordered via our upload form. If you want to reach a higher multiplexing rate, please contact us
If you need a tube label with a barcode you have defined for use in your LIMS system, enter the barcode numbers under "Customer barcode".
You can also use the bubble icon to add a personal note to an oligo.
Check your entries and click on "Add to cart".
Sequence info: ACGT = DNA;
A*C*G*T = PTO ;
I = 2’-Desoxyinosine; U = 2’-Desoxyuridine; [PHO] = Phosphate modification Example: [PHO]TACGCGTACTTCTGTAGCGCTA
UATCGAGTACGTCGCAGCTCGAC
IAGCTCGTACUGAC*G
Use the
IUB code for wobble bases (equal amount of degenerated based)
Special requests:Additional services can be requested via a bespoke offer. Simply click on "Request a quote" and describe your needs in the production comment. Our experts will create the right offer for you, which can be accepted online.