siMAX siRNA - The RNA Interfering Molecule                                            

siMAX siRNA - Customised siRNA

 

 

siMAX siRNA - Maximum gene silencing with siMAX small interfering RNA

 

The purpose of siRNAs is to silence several types of RNA. siRNA is a class of double-stranded RNA molecules. It plays an important role in the RNA interference (RNAi) pathway, where it interferes with the expression of specific genes with complementary nucleotide sequence.

 
 

Highlights of our siMAX siRNA

 

We offer custom siRNAs annealed and ready-to-use:

 

  • Guaranteed purity of 85 % (HPLC purified)
  • Fix quantity of 20 nmol or 40 nmol
  • Sequence lengths: 17 - 27 bases
  • Quality control by MALDI-TOF MS
  • Turnaround time: 8 - 10 working days
  • Delivery: lyophilised in 2 ml screw cap tubes


Additional online features free of charge:

  • Selectable label layouts for your oligo tubes
  • Antisense sequence calculator
  • Online order status and delivery tracking

 

A free 1ml 5x siMAX dilution buffer (30 mM HEPES, 100 mM KCl, 1 mM MgCl2, pH = 7.3) is included with each shipment.

 

21mer versus 27mer siRNA


21mer siRNA molecules are synthesised with either dTdT overhangs or alternate overhangs defined by you:

 

21mer siRNA

 


27mer siRNA may show a much higher efficacy than 21mer siRNAs
.


27mer siRNA, also known as Dicer-substrate RNAs, is reported to be significantly more potent than the traditional 21mer siRNA by taking advantage of Dicer's natural processing. These dsiRNA molecules can also be chemically synthesized. The structure of these RNA duplexes is shown below:

27mer siRNA

 

 
 

 

Related Information

 

 

Resuspension & Annealing

To resuspend the siMAX siRNA duplex


Avoid RNA degradation by using special precautions and by wearing protective lab clothing and gloves. All solutions should be qualified as RNAase-free and reserved only for use in RNA experiments. All RNA work spaces must be free of RNAase contamination. Add the required volume by using the provided siRNA dilution buffer to create your stock solution. Buffer must be diluted with RNase-free water prior to use. 


Annealing


The delivered siRNAs are annealed and ready to use. But if you want to repeat the annealing step:

  • Heat the tube to 90°C for 60 - 90 sec
  • Incubate at 37°C for at least one hour

 

siMAX siRNA controls

Select the sense strand of your preferred siRNA control for copying it into the siMAX siRNA order page.

 

siRNA control Sequence

Lamin A/C µmol

CUGGACUUCCAGAAGAACA

Lamin B2

GAGGAGGAGGAAGCCGAGU

GAPDH

AUUCCAUGGCACCGUCAAG

Luciferase GL2

CGUACGCGGAAUACUUCGA

Luciferase GL3

CUUACGCUGAGUACUUCGA

Green Fluorescent Protein

GGCUACGUCCAGGAGCGCACC

Non Specific Control 31% GC

UAAUGUAUUGGAACGCAUA

Non Specific Control 47% GC

AGGUAGUGUAAUCGCCUUG

Non Specific Control 68% GC

UGCGCUAGGCCUCGGUUGC

 

 

 

 

 

 

 

 

Quality is important for us at Eurofins

Our products and services are produced and performed under strict quality management and quality assurance systems.

Find certificates here