Optimized synthesis process for high quality oligonucleotides with superior performance in NGS applications. - Index Adaptor Primers for incorporation of molecular barcodes (UDIs, CDIs, UDI-UMIs)
- Primers for amplification and sequencing
- Target Capture Probes or blocking oligos
- Other molecular biological applications with low cross-contamination specifications
Specifications:- Typical cross contamination rate of 0.01% - 0.05%
- Available minimum quantities of 4 nmol, 10 nmol and 25 nmol
- DNA sequence length from 15 - 120 bases
- Quality is ensured by ESI-MS (electrospray ionization mass spectrometry)
- An online quality report, including the ESI-MS spectra, can be ordered
- Oligos are supplied in the selected 96well plate in liquid form at the defined concentration
- Selectable solvents are bidest water, TE buffer (10 mM Tris, 1 mM EDTA; pH=8) or Low EDTA Puffer (10 mM Tris, 0.1 mM EDTA pH = 8)
- A minimum of 20 oligos per 96-well plate is required
How to order: We recommend using our Excel template to upload your NGS oligos, where
oligo name and
sequence can be specified per oligo.
Sequence info: ACGT = DNA;
A*C*G*T = PTO ;
I = 2’-Desoxyinosine; U = 2’-Desoxyuridine; [PHO] = Phosphate modification Example: [PHO]TACGCGTACTTCTGTAGCGCTA
UATCGAGTACGTCGCAGCTCGAC
IAGCTCGTACUGAC*G
Use the
IUB code for wobble bases (equal amount of degenerated based)
In the last step, check your entries and then click on "Add to cart".