NGS Built For You
progress bar
progress bar

Häufig gestellte Fragen
Kontaktieren Sie uns
Newsletter abonnieren
w10.0.14 | c1.25.03.1
PROD | u7.5.14
  Quick Order  0
Ecom-Admin
  • Markets
  • Products
  • Company
  • Contact
  • EN
  • Oligonucleotide Synthesis
  • Gene Synthesis & Molecular Biology
  • Sanger Sequencing
  • Next Generation Sequencing
  • Genotyping & Gene Expression

Further Information:

>> EVOcard

>> Product FAQs

>> SALE %

Application Oligos

  • qPCR Probes
  • Ultimate Precision Probes
  • PCR Primer
  • SeqPrimer
  • Cloning Oligos
  • NGSgrade Oligos 2.0
  • NGSgrade Oligos
  • NGS UDI Primer Sets
>> Show more

Custom Oligos

  • Custom DNA Oligos
  • Salt-Free Oligos
  • Large Scale Oligos
  • Custom RNA Oligos
  • Special Requests
>> Show more

Oligo Tools

  • Oligo Analysis Tool
  • PCR Primer Design Tool
  • Sequencing Primer Design Tool
  • qPCR Assay Design Tool
  • siRNA Design Tool
  • Prepaid Oligo Coupons
  • Excel Order Forms
>> Show more

Benefit from more than 25 years of experience in oligonucleotide synthesis!

>> Show all products

Gene Synthesis

  • Standard Genes
  • Express Gene
  • Gene Synthesis Project
  • GENEius
>> Show more

GeneStrands

  • GeneStrands
  • Express GeneStrands

Molecular Biology Services

  • Plasmid Preparation
  • CRISPR/Cas9
>> Show more

Optimise your research and save time with high quality gene synthesis and molecular biology services.

>> Show all products

Sequencing Services

  • Mix2Seq Service
  • LightRun Services
  • TubeSeq Supreme
  • PlateSeq Supreme
  • Direct Colony Sequencing
  • Whole Plasmid Sequencing
  • Primer Walking Service
>> Show more

Prepaid Products

  • Mix2Seq Kits
  • LightRun Barcodes
  • Barcode Labels & Coupons
  • PlateSeq Kits
  • PlateSeq Kit Colony
  • ONT Prepaid Coupons
>> Show more

Additional Services

  • Free Barcode Labels
  • Sequencing Accessories
  • Sequencing Primers
  • Sample Shipment
>> Show more

Hiqh quality Sanger sequencing with highest flexibility for every sample type.

>> Show all products

Top 5 Products

  • INVIEW Resequencing
  • INVIEW Microbiome
  • INVIEW Transcriptome
  • INVIEW Metagenome
  • Amplicon sequencing
  • Bioinformatic services
  • Genome sequencing
>> Show more

Spotlight

  • INVIEW Exome
  • INVIEW Virus
  • INVIEW CRISPR Check
  • NGS Prepaid Coupons
  • Oncology Solutions
  • OLINK Explore 3072
  • Clinical Research Exome
  • Bacteria Hybrid Assembly
>> Show more

Oxford Nanopore Products

  • Whole Plasmid Sequencing
  • Linear / Clonal Amplicons
  • Bacterial Genome Sequencing
  • 16S Full-Length Microbiome
  • Complete ONT Portfolio
>> Show more

NGS from experts - ISO-certified, fully automated and easy to order online.

>> Show all products

Applied Genomic Services

  • DNA Barcoding
  • Cell Line Authentication
  • Mycoplasmacheck
  • Fragment Length Analysis
>> Show more

Genotyping services

  • SNP Genotyping
  • Copy Number Variation
  • Mikrosatellites/ STR/FLA/ IDAA
>> Show more

Gene Expression Services

  • Transcriptome analysis
  • Expression Arrays
  • Target Gene Expression
>> Show more

Cell line authentication, Mycoplasmacheck, Fragment length analysis & tailored projects.

>> Show all products
  • Pharma / Biotech
  • Agrigenomics
  • Consumer Genomics
  • Food & Environment
  • Diagnostic Kit Producer
  • Research / Biotech

Further Information:

>> Quality

>> Events

Synthesis Products

  • Industrial-grade NGS Oligos
  • Ultimate Precision Probes
  • Special Oligo Requests
  • Large Scale Oligos
  • Gene Synthesis
  • GeneStrands
  • Plasmid Preparation

Sequencing Services

  • Amplicon Sequencing
  • Exome Sequencing
  • Transcriptome Sequencing
  • Primer Walking Service

Favorite Content

  • NGS – Disease Diagnostics
  • Cancer Ecology
  • Personalised Cancer Therapy
  • Revolutionising human-like-protein production
  • The Microbiome Of Cancer
  • All about biomarker discovery

Our genomics solutions support you along your drug development chain of small and large molecules and in precision medicine.

>> Show all products

Plant Breeder

  • DNA marker discovery
  • Marker-assisted selection
  • GRAS-Di®
  • Microbiome and metagenomics

Animal Breeder

  • DNA Marker discovery
  • Pathogen screening
  • Parentage testing
  • Genomic selection
  • Marker-assisted selection

Favorite Content

  • Microarrays Accelerate Blue Biotechnology
  • How To Do NGS 50% Faster
  • NGS Portfolio

Benefit from our range of tailored, high throughput genotyping solutions to help you achieve your goals faster, for less.

>> Show all products

Sequencing Services

  • Genotyping
  • Epigenome Profiling
  • Microbiome Analysis
  • Shotgun Sequencing
  • Whole Genome Sequencing

Additional Services

  • Sample Collection Kits
  • Shipping
  • DNA Extraction
  • Laboratory Service
  • Biobanking

Favorite Content

  • Population Genetics
  • The End of Gene Doping
  • Home Genomics Testing
  • IVDR Compliance

Welcome to your full-service laboratory. Benefit from our end-to end solutions for sample collection kit logistics and genomic solutions.

>> Show all products

Food Testing

  • Food Authenticity
  • Meat Traceability
  • Pathogen Traceability
  • Cannabis and Hemp Testing

Environmental Testing

  • Non-targeted detection of organisms / species
  • Targeted detection of organisms / species
  • eDNA Tracker

Favorite Content

  • Determine the Source of Meat
  • Pine Nuts – Why Testing For Edibility Matters

DNA-based solutions to improve and support your analysis, monitoring and traceability across your value chain.

>> Show all products

Synthesis Products

  • Large Scale Oligos
  • Special Requests in Tubes
  • Special Requests in Plates

Quality Assurance

  • GLP
  • ISO 17025
  • ISO 13485

Favorite Content

  • Oligonucleotides For Diagnostics
  • The Future of RNA Applications

Our scalable and high-quality oligonucleotides synthesis offer makes us an ideal partner for your industry applications.

>> Show all products

Favorite Services

  • Custom DNA Oligos
  • TubeSeq Services Sanger
  • INVIEW Microbiome NGS
  • NGS Services
  • GeneStrands

Express Services

  • TubeSeq NightXpress
  • Mix2Seq NightXpress
  • Express Genes
  • Express GeneStrands

Favorite Content

  • Eurofins Genomics Goes Green
  • GENEius – Codon Usage Optimisation
  • 5 tips to speed up your qPCR

For your research project in academic, governmental and industrial environment we have the right genomic service.

>> Show all products

Corporate Information

  • About us
  • Career
  • Events
  • Press Releases
  • Collaborations
  • Blog
  • Newsletter
  • Quality Assurance
  • Lab closure times

Help

  • Video Tutorials
  • Ordering
  • Payment
  • Shipping & Delivery
  • Downloads
  • Data & Privacy
  • Material and Methods

Contact us

Eurofins Genomics
Germany GmbH
Anzinger Str. 7a
85560 Ebersberg
Germany

  • phone +49 7531 816068
  • e-mail support

Get in touch with us!

You need support or advice with your order? You don't find the perfect product or you like to get consultation regarding your results?

>> Get in touch

Find your product

Find your product

  • Sequencing Primer
  • PCR Primer
  • Mycoplasmacheck
  • SALE %
  • TubeSeq

Login to Eurofins

Please login with your email address and password!

>> Login

New at Eurofins Genomics?

Register a new account at Eurofins Genomics!

>> Register
Impersonating: Max Mustermann

Administration

  • Ecom Admin
  • Stop Impersonating

Welcome

Julian Schlossmacher

Login / Register

 
Email
Password:
Forgot password?
Create Account
No SSL
>> Logout >> My profile

Contact

Dr. Melvin Siliakus

+31 629 39 25 66 >> Send message

Account

  • Overview
  • Orders
  • Quotes
  • EVOcards
  • Preferences
  • DropBoxes
  • Sanger Kits & Barcodes
  • NGS Barcodes & Coupons
  • Sanger Samples & Primers
  • Oligo Coupons

Language

model-logo

New Website Navigation explained

>> Close
6

Last added items

0 Item(s)

Go to Cart

>> Go to cart X
 

Quick Order

X

Industrial-grade Products & Services

What are industrial-grade products? <<click here >>

Oligonucleotide Synthesis

  • Ultimate Precision Probes
  • NGSgrade Oligos in Tubes
  • NGSgrade Oligos in Plates
  • Request for Oligos in Tubes
  • Request for Oligos in Plates
  • Large Scale Oligos

Gene Synthesis & Molecular Biology

  • Gene Synthesis
  • GeneStrands
  • Express GeneStrands
  • Plasmid Preparation
  • Cloning Service

Next Generation Sequencing

  • Genome (Re-)Sequencing
  • Transcriptome Sequencing
  • Microbiome profiling
  • Exome Sequencing
  • Clinical Research Exome
  • Oncoprofiling
  • Liquid Biopsy Sample Sequencing
  • Ready-to-Load
  • Virus Sequencing
  • Amplicon Sequencing
  • Metagenome
  • ONT products
  • NGS Barcodes & UPS labels
  • Replacement samples
  • NGS Additional Services

Genotyping & Genexpression

  • Cell Line Authentication
  • Fragment Length Analysis
  • Mycoplasmacheck Barcodes
  • Cell Line Barcodes

Oligonucleotide Synthesis

Primers & Probes for qPCR Applications

  • PCR Primer in Tubes
  • PCR Primer NightXpress
  • PCR Primer in Plates
  • LocNA Primer
  • Dual Labeled Probes
  • MGB Probes
  • LocNA Probe
  • Molecular Beacons
  • LightCycler Probes
  • Probe based qPCR Assay
  • Ultimate Precision Probes

Oligos for Next Generation Sequencing

  • NGSgrade Oligos 2.0 Tubes
  • NGSgrade Oligos 2.0 Plate
  • NGSgrade Oligos in Tubes
  • NGS Oligos for NovaSeq
  • NGS Oligos for MiSeq
  • NGS UDI Primer Sets

Primers for Sanger Sequencing

  • SeqPrimer in Tubes
  • SeqPrimer NightXpress
  • SeqPrimer in Plates
  • Standard Primer

Oligos for Cloning Applications

  • Cloning Oligos
  • EXTREmer Oligos

Custom Oligos

  • Custom DNA Oligos in Tube
  • SaltFree Oligo NightXpress
  • Custom DNA Oligos in Plates
  • Custom RNA Oligos
  • O-Methyl-RNA / Chimerics
  • RNA qPCR Probes
  • siMAX siRNA
  • Special Oligos in Tubes

Oligo Tools

  • Oligo Analysis Tool
  • PCR Primer Design
  • SeqPrimer Design
  • qPCR Assay Design
  • siRNA Assay Design
  • Prepaid Oligo Coupons

Gene Synthesis & Molecular Biology

Synthetic genes

  • Gene Synthesis
  • Combinatorial libraries
  • Gene Synthesis Projects

GeneStrands

  • GeneStrands
  • Express GeneStrands

Molecular Biology Services

  • Plasmid Preparation
  • Site Directed Mutagenesis
  • DNA Cloning Service

Sanger Sequencing

Sanger Sequencing Services

  • TubeSeq Supreme
  • PlateSeq Supreme
  • Direct Colony Sequencing
  • Ready2Load Plate
  • Ready2Load Tube
  • Whole Plasmid Sequencing Tubes
  • Whole Plasmid Sequencing Plate
  • TubeSeq NightXpress
  • Primer Walking Service

Prepaid Products for Sanger Sequencing

  • Prepaid Barcodes & Coupons
  • Mix2Seq Kits
  • PlateSeq Kits
  • LightRun Barcodes
  • ONT Coupons

Additional Services

  • Tube & Plate Barcode Labels
  • Sequencing Accessories
  • Sample Shipment
  • Sequencing Primer Design

Next Generation Sequencing

Genome Sequencing

  • INVIEW Resequencing
  • NGSelect DNA
  • Whole Genome Sequencing
  • Bact. Whole Genome Seq (ONT)

Transcriptome Sequencing

  • INVIEW Transcriptome
  • NGSelect RNA

Metagenome / Microbiome

  • INVIEW Microbiome
  • INVIEW Metagenome

Exome Sequencing & Oncology Solutions

  • INVIEW Human Exome
  • Liquid Biopsy Samples
  • INVIEW Oncoprofiling
  • Clinical Research Exome

CRISPR & Prepaid NGS Coupons

  • INVIEW CRISPR Check
  • Redeem NGS Coupons
  • Order NGS Coupons

VIRUS

  • INVIEW Virus

Plasmid Sequencing

  • INVIEW Plasmid Verification
  • Whole Plasmid Sequencing (ONT) Tubes
  • Whole Plasmid Sequencing (ONT) Plate

Amplicon sequencing & Ready-to-Load

  • NGSelect Amplicon
  • NGSelect Ready-to-Load
  • Clonal Amplicons (ONT)

Oxford Nanopore projects (WGS, Amplicons, 16S)

  • ONT projects

ONT Lite

  • ONT Lite Whole Plasmid Sequencing
  • ONT Lite Clonal Amplicon Sequencing
  • ONT Lite Bacterial Genome Sequencing
  • ONT Lite Assembly Review

Additional Services

  • NGS Barcodes & UPS labels
  • NGS Additional Services
  • Sample Submission Guidelines
  • Prepaid NGS Coupons
  • Replacement samples
  • Request for Information

Genotyping & Gene Expression

Mycoplasmacheck

  • Mycoplasmacheck Barcodes
  • Mycoplasmacheck results

CLA & FLA

  • Cell line authentication Service (CLA)
  • Fragment length Analysis (FLA)
  • Cell line authentication barcodes

Others

  • Genotyping request form

EVOcard

Order / Refill EVOcard

Login / Register

 
Email
Password:
Forgot password?
Create Account
No SSL

 

  • Order Menu

    EVOcards

    • EVOcard bestellen / aufladen

    Oligonucleotides & siRNA

    • (q)PCR Primer in Tubes
    • (q)PCR Primer in Platte
    • (q)PCR Primer NightXpress
    • SeqPrimer in Tubes
    • SeqPrimer in Platte
    • SeqPrimer NightXpress
    • Custom DNA Oligos in Tubes
    • Custom DNA Oligos in Platte
    • SaltFree Oligo NightXpress
    • NGSgrade Oligos in Tubes
    • Standard Primer
    • Standard Primer NightXpress
    • LocNA Primer
    • LocNA Probes
    • Dual Labeled Probes
    • MGB Probes
    • Probe based qPCR Assay
    • Cloning Oligos in Tubes
    • EXTREmer Oligos
    • Nano-Scale Plate Oligos
    • NGS UDI Primer Sets
    • Custom RNA Oligos
    • RNA qPCR Probes
    • siMAX siRNA
    • Large Scale Oligos
    • Spezialanfragen
    • Mehr...

    Custom DNA Sequencing

    • Mix2Seq Kits
    • LightRun Barcodes
    • Sequenzier-Primer
    • TubeSeq Service
    • SupremeRun Tube
    • Tube & Platten Barcode Labels
    • TubeSeq Labels & Coupons
    • SupremeRun Barcodes
    • Sequenzier-Accessories
    • PlateSeq Kits
    • SupremeRun 96
    • Primer Walking
    • PlateSeq Service
    • SupremeRun | Multiprimer
    • Sequenzierprojekte
    • Direct Colony Sequencing
    • Ready2Load Plate
    • Mehr...

    Next Generation Sequencing

    • INVIEW Microbiom Profiling
    • NGSelect DNA
    • Barcode & UPS Labels
    • INVIEW Transcriptome
    • NGSelect RNA
    • Angebotsanfrage
    • INVIEW Exom
    • NGSelect Amplikon
    • Ersatzproben
    • INVIEW Resequencing
    • NGSelect Amplicon 2nd PCR
    • Probenvorbereitung
    • INVIEW CRISPR Check
    • Coupons einlösen
    • Mehr ...
    • INVIEW Oncopanel
    • SARS-CoV-2 RNA-Seq

    Gene Synthesis & Molecular Biology

    • Gen-Bestellseite
    • Plasmid Präparation
    • GeneStrands
    • Express Gene
    • DNA Klonierung
    • Genbibliotheken
    • Gensynthese Projekte
    • Ortsgerichtete Mutagenese
    • Express GeneStrands
    • Corona Kontrollplasmide

    Genotyping & Gene Expression

    • Zelllinienauthentifizierung
    • Mycoplasmacheck
    • Fragmentlängen-Analyse
    • Zelllinien-Barcodes
    • Angebotsanfrage

0 Item(s)

Go to Cart

  • DNA & RNA
    Oligonucleotides
    • >

      Optimised Application Oligos

    • >
      PCR Primers
    • >
      SeqPrimer
    • >
      Cloning Oligo
    • >
      EXTREmers
    • >
      NGSgrade Oligos
    • >

      qPCR Probes

    • >
      Custom DNA & RNA Oligos
    • >
      Custom DNA Oligos
    • >
      Large-Scale Oligos
    • >
      Custom RNA Oligos
    • >
      siMAX siRNA
    • >
      Spezialanfragen
  • Custom DNA
    Sequencing
    • >

      Eurofins Services

    • >
      Mix2Seq
    • >
      Mix2Seq Kits
    • >
      TubeSeq Services
    • >
      TubeSeq Labels & Coupons
    • >
      PlateSeq Service
    • >
      PlateSeq Kits
    • >
      Direct Colony Sequencing
    • >
      Whole Plasmid Sequencing
    • >

      LightRun Services

    • >
      LightRun Barcodes
    • >
      GATC Services
    • >

      Zusätzliche Services

    • >
      Tube & Platten Barcode Labels
    • >
      Sequenzier-Primer
    • >
      Sequenzier-Accessories
    • >
      Probenversand
    • >
      Kostenlose Probenabholung
  • Next Generation Sequencing
    • >

      NGS Built For You

    • >
      INVIEW Microbiome
    • >
      INVIEW Metagenome
    • >
      INVIEW Transcriptome
    • >
      INVIEW Exome
    • >
      INVIEW CRISPR Check
    • >
      INVIEW Virus
    • >
      NGS Prepaid Coupons
    • >
      INVIEW Plasmid Verification
    • >

      NGS Build Your Own

    • >
      NGSelect DNA
    • >
      NGSelect RNA
    • >
      NGSelect Amplikon
    • >
      NGSelect Ready2Load
    • >

      NGS Projekte

    • >
      Genom-Sequenzierung
    • >

      Anwendungen

    • >
      Onkologie Lösungen
  • Gensynthese & Molekularbiologie
    • >

      Gensynthese

    • >
      Standard Gene
    • >
      Express Gene
    • >
      Komplexe Gene
    • >
      Genbibliotheken
    • >
      GeneStrands
    • >
      Express GeneStrands
    • >
      Gene im neuen Shop
    • >

      GENEius

    • >
      Sequenzoptimierung
    • >
      Codon Usage Anpassung
    • >
      GENEius Und Ecom
    • >

      Molekularbiologische Services

    • >
      Plasmid Präparation
    • >
      Ortsgerichtete Mutagenese
    • >

      Anwendungen

    • >
      CRISPR/Cas9
  • Genotypisierung & Genexpression
    • >

      Service Plattformen

    • >
      Illumina Array Plattformen
    • >
      Affymetrix Array Plattformen
    • >
      Fluidigm BioMark & EP1
    • >
      Roche LightCycler
    • >
      Sanger Sequenzierung & NGS
    • >

      Genotypisierung Services

    • >
      SNP Genotypisierung
    • >
      Mikrosatelliten / STR / FLA / IDAA
    • >
      Mittels Sequenzierung
    • >
      Genotypisierung mittels PCR
    • >
      Genom-weite Assoziationen
    • >
      Humanidentifizierung
    • >
      Copy Number Variation
    • >

      Genexpression Services

    • >
      Transkriptomanalyse
    • >
      Expressionsarrays
    • >
      Target Gene Expression
    • >
      miRNA / small RNA Analyse
    • >

      Applied Genomics Services

    • >
      Residual DNA Nachweis
    • >
      DNA Barcoding
    • >
      Zelllinienauthentifizierung
    • >
      Mycoplasmacheck

INVIEW Microbiome

  • You are here:
  • Next Generation Sequencing >
  • NGS Built For You >
  • INVIEW Microbiome

 

 

Bestimmen Sie die Mikroorganismen in Ihrer Probe

 


Unsere INVIEW Microbiome Profiling-Lösung bietet eine hochsensitive Identifizierung und Klassifizierung von Bakterien, Pilzen und Archaeen, einschließlich 16S-, 18S- und ITS-Studien, sowie Populationsanalysen für eine Vielzahl von Umwelt-, Lebensmittel- und klinischen Proben.

Eurofins Genomics amplifiziert und sequenziert bis zu <570 bp der hypervariablen Regionen der 16S- und 18S-rRNA-Gene sowie des Internal Transcribed Spacer (ITS)-Gens von Pilzen. Sollte Ihr Ziel nicht durch etablierte Primer-Sets abgedeckt sein, bieten wir einen maßgeschneiderten Implementierungsservice, um Ihre Anforderungen zu erfüllen.

Wählen Sie unsere Standardoption, die ca. 20.000 Reads pro Probe (ohne Garantie) bereitstellt, oder entscheiden Sie sich für unsere Premium-Pakete mit garantierten 60.000 Reads für verbesserte Datenqualität zu wettbewerbsfähigen Preisen.

Für 16S-Vollsequenzierungen nutzen Sie bitte unseren neuen V1V9-16S-Long-Read-Sequenzierungsservice hier.

Wenn Sie Ihre eigenen 16S-, 18S- oder ITS-Amplicons vorbereiten, empfehlen wir die Nutzung unserer Amplicon-Sequenzierungsdienste (Illumina & ONT).

.

 

 

 

 

>> angebot/ Bestellung

Kostenlose BarcodeS

>> CouponS Einlösen

 

 

 

Höhepunkte

  •  Kein Limit bei der Anzahl der Proben
  • Ultragünstige Preise bei mehr als 192 Proben pro Charge
  • Erzeugung von 1 bis 4 Amplicons pro DNA-Probe (Auswahl aus unserer Ziel-Liste)
  • Illumina-Sequenzierung mit 2 x 300 bp Paired-End-Read-Modul
  • Durchführung der Dienstleistungen in ISO17025-zertifizierten Laboren
  • Umfassende Bioinformatik-Dienste und interaktive Analyseberichte
  • Datentransfer über sichere FTP-Verbindungen

Anwendungen & Services

  • Wir bieten optionale Bioinformatik-Dienstleistungen an, einschließlich Trimming und Zusammenführung überlappender Paired-End-Reads sowie umfassendes 16S-Mikrobiom-Profiling mit Taxon-Identifikation.
  • Für unseren optionalen DNA-Isolierungsservice verwenden Sie bitte unseren Probenvorbereitungs-Guide.

Proben mit einem höheren Biosicherheitsniveau als S2 werden nicht akzeptiert. GVOs (gentechnisch veränderte Organismen) werden nur mit Sicherheitsstufe S1 akzeptiert.

 

 

>> FAQ's MiKrobiom

>> NGS Prepaid Coupons

>> Proben- vorbereitung

>> 16S Voll-Längen Sequenzierung

 

 

 

Produktspezifikationen & Bestellung

 

  

Spezifikationen
Premium - 60k Read Paare
Standard - 20k Read Paare
Hochdurchsatz- 20k Read Paare
Anzahl Proben Ab 1 Probe Ab 12 Proben Ab 184 Proben
Lauf-Modus 2 x 300 bp 2 x 300 bp 2 x 300 bp
Read-Menge 60k Read Paare 20k Read Paare 20k Read Paare
Garantierte Reads Ja Nein Nein
Zielregion-Auswahl Standard & nicht-standard Zielregionen Standard & nicht-standard Zielregionen Standard & nicht-standard Zielregionen
Trimming & merging von überlappenden Reads Optional Optional Included
Mikrobiom-Analyse Optional Optional Optional

 

 

 

Spezifikationen

  • Erzeugung von 1 – 4 Amplicons pro DNA-Probe (Auswahl aus unserer Ziel-Liste)
  • Qualitätskontrolle nach zielgerichteter Amplifikation
  • Pooling und Normalisierung der Amplicons
  • Sequenzierung auf Illuminas MiSeq mit dem 2 x 300 bp Paired-End-Read-Modul
  • Bereitstellung von durchschnittlich 20.000 Read-Paaren oder garantierten 60.000 Read-Paaren pro Amplicon (+/- 3 %)

 

 

Ausgangsmaterial

  • Probentyp: Gereinigte DNA
  • Reinheit (OD260/280): 1,8–2,0
  • Volumen: Für 1 Ziel: 20 µL
    Für jedes zusätzliche Ziel: +10 µL (z. B. 50 µL für 4 Ziele)
  • Konzentration: 10–50 ng/µL
  • Mindestmenge: 200 ng
  • Resuspensionspuffer: Wasser, EB oder Low TE (<0,1 mM EDTA)
  • Format: Barcode-beschriftete Röhrchen oder Platten
  • Versandmethode: Raumtemperatur/Eis

 

Röhrchen / Tube format: 1,5 ml Safe-Lock-Röhrchen

Plattenformat: Eppendorf twin.tec PCR Platte 96, semi-skirted; Positionen G12 & H12 leer lassen

 

 

Standard - Zielregionen

Falls Ihr Ziel nicht durch unsere etablierten Standard- oder Nicht-Standard-Primer-Sets abgedeckt ist, bieten wir einen maßgeschneiderten Implementierungsservice, um Ihre Anforderungen zu erfüllen.

Organism Gene Region Primer Name Amplicon Length (bp) Primer Sequence Orientation Reference
Bacteria 16S V1-V3 27F 500 AGAGTTTGATCATGGCTCAG F Weisburg et al., 1991
530R GTATTACCGCGGCTGCTG R Leser T.D. et al., 2002
Bacteria 16S V3-V4 347F 430  TACGGGAGGCAGCAG F Turner et al., 1999
800R CCAGGGTATCTAATCC R Kisand et al., 2002
Bacteria 16S V3-V5 341F 570  CCTACGGGNGGCWGCAG F Herlemann et al., 2011
926R CCGYCAATTYMTTTRAGTTT R Quince et al., 2011, EMP
Archaea 16S V3-V4 340F 450  CCCTAYGGGGYGCASCAG F Gantner et al. 2011
806R GGACTACNVGGGTWTCTAAT R Apprill et al., 2015
Fungi ITS1    ITS5F 100-1000*  GGAAGTAAAAGTCGTAACAAGG F White et al., 1990
ITS2R GCTGCGTTCTTCATCGATGC R White et al., 1990
Fungi ITS2    ITSbF 100-800*  GCATCGATGAAGAACGCAGC F White et al., 1990
ITSbR TCCTCCGCTTATTGATATGC R White et al., 1990

 

 

* Die Länge der ITS-Region bei Pilzen kann je nach spezifischer Spezies erheblich variieren.

 

 

Nicht-standard Zielregionen

 

 

 

Organism Gene Region Primer Name Amplicon Length (bp) Primer Sequence Orientation Reference
Bacteria 16S V4 515F 270

GTGYCAGCMGCCGCGGTAA F Parada et al., 2016
806R GGACTACNVGGGTWTCTAAT R Apprill et al., 2015
Bacteria 16S V1-V3 27F 500  AGRGTTYGATYMTGGCTCAG F Walker et al., 2015
534R ATTACCGCGGCTGCTGG R Muyzer et al., 1993
Bacteria 16S V3-V4 341F 450  CCTACGGGNGGCWGCAG F Herlemann et al., 2011
806R GGACTACNVGGGTWTCTAAT R Apprill et al., 2015
Bacteria 16S V3-V4 341F 450  CCTACGGGNGGCWGCAG F Herlemann et al., 2011
805R GACTACHVGGGTATCTAATCC R Nalashenkov et al., 2021
Fungi 18S    FungiF1_F 340*  GTGGTAATTCTAGAGCTAATACATGCT F in-house developed
FungiF1_R CCTGTATCAGTATTTATTGTCACTAC R in-house developed
Fungi ITS1    ITS1F 100-1000*  TCCGTAGGTGAACCTGCGG F White et al., 1990
ITS2R GCTGCGTTCTTCATCGATGC R White et al., 1990
Fungi ITS2   fITS7F 100-800* GTGARTCATCGAATCTTTG F Ihrmark et al, 2012
ITSbR TCCTCCGCTTATTGATATGC R White et al. 1990

 

 

* Die Länge der ITS-Region bei Pilzen kann je nach spezifischer Spezies erheblich variieren.

 

Lieferumfang

Liste der gelieferten Ergebnisse: Rohdaten:

  • FASTQ-Dateien
  • Optional: Getrimmte und zusammengeführte FASTQ-Dateien
  • Optional: Analyse für umfassendes Mikrobiom-Profiling:
    • Umfassender Profiling-Bericht (.PDF) Taxonomie-Tabellen (.TXT)
    • OTU-Tabellen (inklusive normalisierter Abundanzschätzung) (.TXT, .BIOM)
    • Lese-Sequenzen der OTU-Vertreter (.FASTA)
    • Verarbeitete Lese-Sequenzen, die in den OTU-Auswahlprozess einfließen (.FASTA)
    • Taxonomie-Diagramme
    • Einblick in unseren Mikrobiom-Analysebericht unten verfügbar.

 

 

Literatur

 

INVIEW Microbiome mit BioIT Demo Report

Sie erhalten einen Demo-PDF-Bericht, aber Ihr umfassender Analysebericht wird im interaktiven HTML-Format vorliegen.

Pressemitteilung: Accredited NGS Tests for Identification of Non-Targeted Microorganism

 

 

 

 

 

 

 

Das könnte Ihnen auch gefallen

 

 

 

INVIEW Metagenome


Untersuchen Sie die Mikrobiota in Ihrer Probe


>> Mehr Erfahren

 

 

 

NGS Coupons


Die perfekte "Prepaid"-Lösung für Ihr NGS Projekt


>> mehr erfahren

 

 

 

NGSgrade Oligos


Verbessern Sie Ihre NextGen-Sequenzierergebnisse


>> mehr erfahren

 

 

 

16S Voll-Längen Seq


Sequenzieren Sie das komplette 16S Gen mit ONT


>> mehr erfahren

 

 

Qualität hat bei Eurofins höchsten Stellenwert

Unsere Produkte und Dienstleistungen werden unter strengen Qualitätsmanagement- und Qualitätssicherungssystemen hergestellt und durchgeführt.

Zertifikate finden Sie hier

Qualität ist uns sehr wichtig

Unsere Produkte und Services werden unter strengen Qualitätsrichtlinien produziert und durchgeführt.

Hier geht's zu den Zertifikaten
Production Site
  • Europe
  • America
  • India
  • Japan
Eurofins Genomics
  • Terms & Conditions
  • Sitemap
  • Imprint
  • Privacy
  • Licenses
  • Cookie Settings
Contact
General Customer Support
phone +49 7531 816068
Toll free phone number for
Europe: 00800 200 100 20
support-eu@genomics.eurofinseu.com

Eurofins Genomics Europe Shared Services GmbH
Anzinger Str. 7a
85560 Ebersberg
Germany

/p>

2025 - Eurofins Genomics

VEGA Beta