The Amplicon 2nd PCR Oligos have been developed especially to allow pooling of samples for NGS on Illumina They are designed and validated by our in-house NextGen sequencing lab.
How it works- You provide amplicons generated with NGS primers consisting of the target specific sequences and a universal adapter sequence
- During library prep, Eurofins Genomics adds indexed sequencing adaptors necessary for sample discrimination
How to order- Please download our Excel template first, which is specifically coded for designing your 2nd PCR primers
- Each PCR product must harbor universal adaptors on both ends of the fragment
- We are directly adding the required adaptor sequences to the target specific primer sequences you are uploading
- For a correct design, you must provide those sequences in 5’ -3’ direction
- You may provide in the upload form different forward and reverse primers in case you are targeting more than one region
- Upload the filled Excel form and press "Next". Options for synthesis scales and delivery format are found in the next step
- Check your uploaded sequences on the next step and press "Add to Cart"
Adaptor sequences- Forward Primer Sequence: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
- Reverse Primer Sequence: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT