NGSgrade 2nd PCR Oligos
progress bar
progress bar

Häufig gestellte Fragen
Kontaktieren Sie uns
Newsletter abonnieren
w10.0.14 | c1.25.03.1
PROD | u7.5.14
  Quick Order  0
Ecom-Admin
  • Markets
  • Products
  • Company
  • Contact
  • EN
  • Oligonucleotide Synthesis
  • Gene Synthesis & Molecular Biology
  • Sanger Sequencing
  • Next Generation Sequencing
  • Genotyping & Gene Expression

Further Information:

>> EVOcard

>> Product FAQs

>> SALE %

Application Oligos

  • qPCR Probes
  • Ultimate Precision Probes
  • PCR Primer
  • SeqPrimer
  • Cloning Oligos
  • NGSgrade Oligos 2.0
  • NGSgrade Oligos
  • NGS UDI Primer Sets
>> Show more

Custom Oligos

  • Custom DNA Oligos
  • Salt-Free Oligos
  • Large Scale Oligos
  • Custom RNA Oligos
  • Special Requests
>> Show more

Oligo Tools

  • Oligo Analysis Tool
  • PCR Primer Design Tool
  • Sequencing Primer Design Tool
  • qPCR Assay Design Tool
  • siRNA Design Tool
  • Prepaid Oligo Coupons
  • Excel Order Forms
>> Show more

Benefit from more than 25 years of experience in oligonucleotide synthesis!

>> Show all products

Gene Synthesis

  • Standard Genes
  • Express Gene
  • Gene Synthesis Project
  • GENEius
>> Show more

GeneStrands

  • GeneStrands
  • Express GeneStrands

Molecular Biology Services

  • Plasmid Preparation
  • CRISPR/Cas9
>> Show more

Optimise your research and save time with high quality gene synthesis and molecular biology services.

>> Show all products

Sequencing Services

  • Mix2Seq Service
  • LightRun Services
  • TubeSeq Supreme
  • PlateSeq Supreme
  • Direct Colony Sequencing
  • Whole Plasmid Sequencing
  • Primer Walking Service
>> Show more

Prepaid Products

  • Mix2Seq Kits
  • LightRun Barcodes
  • Barcode Labels & Coupons
  • PlateSeq Kits
  • PlateSeq Kit Colony
  • ONT Prepaid Coupons
>> Show more

Additional Services

  • Free Barcode Labels
  • Sequencing Accessories
  • Sequencing Primers
  • Sample Shipment
>> Show more

Hiqh quality Sanger sequencing with highest flexibility for every sample type.

>> Show all products

Top 5 Products

  • INVIEW Resequencing
  • INVIEW Microbiome
  • INVIEW Transcriptome
  • INVIEW Metagenome
  • Amplicon sequencing
  • Bioinformatic services
  • Genome sequencing
>> Show more

Spotlight

  • INVIEW Exome
  • INVIEW Virus
  • INVIEW CRISPR Check
  • NGS Prepaid Coupons
  • Oncology Solutions
  • OLINK Explore 3072
  • Clinical Research Exome
  • Bacteria Hybrid Assembly
>> Show more

Oxford Nanopore Products

  • Whole Plasmid Sequencing
  • Linear / Clonal Amplicons
  • Bacterial Genome Sequencing
  • 16S Full-Length Microbiome
  • Complete ONT Portfolio
>> Show more

NGS from experts - ISO-certified, fully automated and easy to order online.

>> Show all products

Applied Genomic Services

  • DNA Barcoding
  • Cell Line Authentication
  • Mycoplasmacheck
  • Fragment Length Analysis
>> Show more

Genotyping services

  • SNP Genotyping
  • Copy Number Variation
  • Mikrosatellites/ STR/FLA/ IDAA
>> Show more

Gene Expression Services

  • Transcriptome analysis
  • Expression Arrays
  • Target Gene Expression
>> Show more

Cell line authentication, Mycoplasmacheck, Fragment length analysis & tailored projects.

>> Show all products
  • Pharma / Biotech
  • Agrigenomics
  • Consumer Genomics
  • Food & Environment
  • Diagnostic Kit Producer
  • Research / Biotech

Further Information:

>> Quality

>> Events

Synthesis Products

  • Industrial-grade NGS Oligos
  • Ultimate Precision Probes
  • Special Oligo Requests
  • Large Scale Oligos
  • Gene Synthesis
  • GeneStrands
  • Plasmid Preparation

Sequencing Services

  • Amplicon Sequencing
  • Exome Sequencing
  • Transcriptome Sequencing
  • Primer Walking Service

Favorite Content

  • NGS – Disease Diagnostics
  • Cancer Ecology
  • Personalised Cancer Therapy
  • Revolutionising human-like-protein production
  • The Microbiome Of Cancer
  • All about biomarker discovery

Our genomics solutions support you along your drug development chain of small and large molecules and in precision medicine.

>> Show all products

Plant Breeder

  • DNA marker discovery
  • Marker-assisted selection
  • GRAS-Di®
  • Microbiome and metagenomics

Animal Breeder

  • DNA Marker discovery
  • Pathogen screening
  • Parentage testing
  • Genomic selection
  • Marker-assisted selection

Favorite Content

  • Microarrays Accelerate Blue Biotechnology
  • How To Do NGS 50% Faster
  • NGS Portfolio

Benefit from our range of tailored, high throughput genotyping solutions to help you achieve your goals faster, for less.

>> Show all products

Sequencing Services

  • Genotyping
  • Epigenome Profiling
  • Microbiome Analysis
  • Shotgun Sequencing
  • Whole Genome Sequencing

Additional Services

  • Sample Collection Kits
  • Shipping
  • DNA Extraction
  • Laboratory Service
  • Biobanking

Favorite Content

  • Population Genetics
  • The End of Gene Doping
  • Home Genomics Testing
  • IVDR Compliance

Welcome to your full-service laboratory. Benefit from our end-to end solutions for sample collection kit logistics and genomic solutions.

>> Show all products

Food Testing

  • Food Authenticity
  • Meat Traceability
  • Pathogen Traceability
  • Cannabis and Hemp Testing

Environmental Testing

  • Non-targeted detection of organisms / species
  • Targeted detection of organisms / species
  • eDNA Tracker

Favorite Content

  • Determine the Source of Meat
  • Pine Nuts – Why Testing For Edibility Matters

DNA-based solutions to improve and support your analysis, monitoring and traceability across your value chain.

>> Show all products

Synthesis Products

  • Large Scale Oligos
  • Special Requests in Tubes
  • Special Requests in Plates

Quality Assurance

  • GLP
  • ISO 17025
  • ISO 13485

Favorite Content

  • Oligonucleotides For Diagnostics
  • The Future of RNA Applications

Our scalable and high-quality oligonucleotides synthesis offer makes us an ideal partner for your industry applications.

>> Show all products

Favorite Services

  • Custom DNA Oligos
  • TubeSeq Services Sanger
  • INVIEW Microbiome NGS
  • NGS Services
  • GeneStrands

Express Services

  • TubeSeq NightXpress
  • Mix2Seq NightXpress
  • Express Genes
  • Express GeneStrands

Favorite Content

  • Eurofins Genomics Goes Green
  • GENEius – Codon Usage Optimisation
  • 5 tips to speed up your qPCR

For your research project in academic, governmental and industrial environment we have the right genomic service.

>> Show all products

Corporate Information

  • About us
  • Career
  • Events
  • Press Releases
  • Collaborations
  • Blog
  • Newsletter
  • Quality Assurance
  • Lab closure times

Help

  • Video Tutorials
  • Ordering
  • Payment
  • Shipping & Delivery
  • Downloads
  • Data & Privacy
  • Material and Methods

Contact us

Eurofins Genomics
Germany GmbH
Anzinger Str. 7a
85560 Ebersberg
Germany

  • phone +49 7531 816068
  • e-mail support

Get in touch with us!

You need support or advice with your order? You don't find the perfect product or you like to get consultation regarding your results?

>> Get in touch

Find your product

Find your product

  • Sequencing Primer
  • PCR Primer
  • Mycoplasmacheck
  • SALE %
  • TubeSeq

Login to Eurofins

Please login with your email address and password!

>> Login

New at Eurofins Genomics?

Register a new account at Eurofins Genomics!

>> Register
Impersonating: Max Mustermann

Administration

  • Ecom Admin
  • Stop Impersonating

Welcome

Julian Schlossmacher

Login / Register

 
Email
Email can not be empty
Password:
Password can not be empty
Forgot password?
Create Account
No SSL
>> Logout >> My profile

Contact

Dr. Melvin Siliakus

+31 629 39 25 66 >> Send message

Account

  • Overview
  • Orders
  • Quotes
  • EVOcards
  • Preferences
  • DropBoxes
  • Sanger Kits & Barcodes
  • NGS Barcodes & Coupons
  • Sanger Samples & Primers
  • Oligo Coupons

Language

model-logo

New Website Navigation explained

>> Close
6

Last added items

0 Item(s)

Go to Cart

>> Go to cart X
 

Quick Order

X

Industrial-grade Products & Services

What are industrial-grade products? <<click here >>

Oligonucleotide Synthesis

  • Ultimate Precision Probes
  • NGSgrade Oligos in Tubes
  • NGSgrade Oligos in Plates
  • Request for Oligos in Tubes
  • Request for Oligos in Plates
  • Large Scale Oligos

Gene Synthesis & Molecular Biology

  • Gene Synthesis
  • GeneStrands
  • Express GeneStrands
  • Plasmid Preparation
  • Cloning Service

Next Generation Sequencing

  • Genome (Re-)Sequencing
  • Transcriptome Sequencing
  • Microbiome profiling
  • Exome Sequencing
  • Clinical Research Exome
  • Oncoprofiling
  • Liquid Biopsy Sample Sequencing
  • Ready-to-Load
  • Virus Sequencing
  • Amplicon Sequencing
  • Metagenome
  • ONT products
  • NGS Barcodes & UPS labels
  • Replacement samples
  • NGS Additional Services

Genotyping & Genexpression

  • Cell Line Authentication
  • Fragment Length Analysis
  • Mycoplasmacheck Barcodes
  • Cell Line Barcodes

Oligonucleotide Synthesis

Primers & Probes for qPCR Applications

  • PCR Primer in Tubes
  • PCR Primer NightXpress
  • PCR Primer in Plates
  • LocNA Primer
  • Dual Labeled Probes
  • MGB Probes
  • LocNA Probe
  • Molecular Beacons
  • LightCycler Probes
  • Probe based qPCR Assay
  • Ultimate Precision Probes

Oligos for Next Generation Sequencing

  • NGSgrade Oligos 2.0 Tubes
  • NGSgrade Oligos 2.0 Plate
  • NGSgrade Oligos in Tubes
  • NGS Oligos for NovaSeq
  • NGS Oligos for MiSeq
  • NGS UDI Primer Sets

Primers for Sanger Sequencing

  • SeqPrimer in Tubes
  • SeqPrimer NightXpress
  • SeqPrimer in Plates
  • Standard Primer

Oligos for Cloning Applications

  • Cloning Oligos
  • EXTREmer Oligos

Custom Oligos

  • Custom DNA Oligos in Tube
  • SaltFree Oligo NightXpress
  • Custom DNA Oligos in Plates
  • Custom RNA Oligos
  • O-Methyl-RNA / Chimerics
  • RNA qPCR Probes
  • siMAX siRNA
  • Special Oligos in Tubes

Oligo Tools

  • Oligo Analysis Tool
  • PCR Primer Design
  • SeqPrimer Design
  • qPCR Assay Design
  • siRNA Assay Design
  • Prepaid Oligo Coupons

Gene Synthesis & Molecular Biology

Synthetic genes

  • Gene Synthesis
  • Combinatorial libraries
  • Gene Synthesis Projects

GeneStrands

  • GeneStrands
  • Express GeneStrands

Molecular Biology Services

  • Plasmid Preparation
  • Site Directed Mutagenesis
  • DNA Cloning Service

Sanger Sequencing

Sanger Sequencing Services

  • TubeSeq Supreme
  • PlateSeq Supreme
  • Direct Colony Sequencing
  • Ready2Load Plate
  • Ready2Load Tube
  • Whole Plasmid Sequencing Tubes
  • Whole Plasmid Sequencing Plate
  • TubeSeq NightXpress
  • Primer Walking Service

Prepaid Products for Sanger Sequencing

  • Prepaid Barcodes & Coupons
  • Mix2Seq Kits
  • PlateSeq Kits
  • LightRun Barcodes
  • ONT Coupons

Additional Services

  • Tube & Plate Barcode Labels
  • Sequencing Accessories
  • Sample Shipment
  • Sequencing Primer Design

Next Generation Sequencing

Genome Sequencing

  • INVIEW Resequencing
  • NGSelect DNA
  • Whole Genome Sequencing
  • Bact. Whole Genome Seq (ONT)

Transcriptome Sequencing

  • INVIEW Transcriptome
  • NGSelect RNA

Metagenome / Microbiome

  • INVIEW Microbiome
  • INVIEW Metagenome

Exome Sequencing & Oncology Solutions

  • INVIEW Human Exome
  • Liquid Biopsy Samples
  • INVIEW Oncoprofiling
  • Clinical Research Exome

CRISPR & Prepaid NGS Coupons

  • INVIEW CRISPR Check
  • Redeem NGS Coupons
  • Order NGS Coupons

VIRUS

  • INVIEW Virus

Plasmid Sequencing

  • INVIEW Plasmid Verification
  • Whole Plasmid Sequencing (ONT) Tubes
  • Whole Plasmid Sequencing (ONT) Plate

Amplicon sequencing & Ready-to-Load

  • NGSelect Amplicon
  • NGSelect Ready-to-Load
  • Clonal Amplicons (ONT)

Oxford Nanopore projects (WGS, Amplicons, 16S)

  • ONT projects

ONT Lite

  • ONT Lite Whole Plasmid Sequencing
  • ONT Lite Clonal Amplicon Sequencing
  • ONT Lite Bacterial Genome Sequencing
  • ONT Lite Assembly Review

Additional Services

  • NGS Barcodes & UPS labels
  • NGS Additional Services
  • Sample Submission Guidelines
  • Prepaid NGS Coupons
  • Replacement samples
  • Request for Information

Genotyping & Gene Expression

Mycoplasmacheck

  • Mycoplasmacheck Barcodes
  • Mycoplasmacheck results

CLA & FLA

  • Cell line authentication Service (CLA)
  • Fragment length Analysis (FLA)
  • Cell line authentication barcodes

Others

  • Genotyping request form

EVOcard

Order / Refill EVOcard

Login / Register

 
Email
Email can not be empty
Password:
Password can not be empty
Forgot password?
Create Account
No SSL

 

  • Order Menu

    EVOcards

    • EVOcard bestellen / aufladen

    Oligonucleotides & siRNA

    • (q)PCR Primer in Tubes
    • (q)PCR Primer in Platte
    • (q)PCR Primer NightXpress
    • SeqPrimer in Tubes
    • SeqPrimer in Platte
    • SeqPrimer NightXpress
    • Custom DNA Oligos in Tubes
    • Custom DNA Oligos in Platte
    • SaltFree Oligo NightXpress
    • NGSgrade Oligos in Tubes
    • Standard Primer
    • Standard Primer NightXpress
    • LocNA Primer
    • LocNA Probes
    • Dual Labeled Probes
    • MGB Probes
    • Probe based qPCR Assay
    • Cloning Oligos in Tubes
    • EXTREmer Oligos
    • Nano-Scale Plate Oligos
    • NGS UDI Primer Sets
    • Custom RNA Oligos
    • RNA qPCR Probes
    • siMAX siRNA
    • Large Scale Oligos
    • Spezialanfragen
    • Mehr...

    Custom DNA Sequencing

    • Mix2Seq Kits
    • LightRun Barcodes
    • Sequenzier-Primer
    • TubeSeq Service
    • SupremeRun Tube
    • Tube & Platten Barcode Labels
    • TubeSeq Labels & Coupons
    • SupremeRun Barcodes
    • Sequenzier-Accessories
    • PlateSeq Kits
    • SupremeRun 96
    • Primer Walking
    • PlateSeq Service
    • SupremeRun | Multiprimer
    • Sequenzierprojekte
    • Direct Colony Sequencing
    • Ready2Load Plate
    • Mehr...

    Next Generation Sequencing

    • INVIEW Microbiom Profiling
    • NGSelect DNA
    • Barcode & UPS Labels
    • INVIEW Transcriptome
    • NGSelect RNA
    • Angebotsanfrage
    • INVIEW Exom
    • NGSelect Amplikon
    • Ersatzproben
    • INVIEW Resequencing
    • NGSelect Amplicon 2nd PCR
    • Probenvorbereitung
    • INVIEW CRISPR Check
    • Coupons einlösen
    • Mehr ...
    • INVIEW Oncopanel
    • SARS-CoV-2 RNA-Seq

    Gene Synthesis & Molecular Biology

    • Gen-Bestellseite
    • Plasmid Präparation
    • GeneStrands
    • Express Gene
    • DNA Klonierung
    • Genbibliotheken
    • Gensynthese Projekte
    • Ortsgerichtete Mutagenese
    • Express GeneStrands
    • Corona Kontrollplasmide

    Genotyping & Gene Expression

    • Zelllinienauthentifizierung
    • Mycoplasmacheck
    • Fragmentlängen-Analyse
    • Zelllinien-Barcodes
    • Angebotsanfrage

0 Item(s)

Go to Cart

  • DNA & RNA
    Oligonucleotides
    • >

      Optimised Application Oligos

    • >
      PCR Primers
    • >
      SeqPrimer
    • >
      Cloning Oligo
    • >
      EXTREmers
    • >
      NGSgrade Oligos
    • >

      qPCR Probes

    • >
      Custom DNA & RNA Oligos
    • >
      Custom DNA Oligos
    • >
      Large-Scale Oligos
    • >
      Custom RNA Oligos
    • >
      siMAX siRNA
    • >
      Spezialanfragen
  • Custom DNA
    Sequencing
    • >

      Eurofins Services

    • >
      Mix2Seq
    • >
      Mix2Seq Kits
    • >
      TubeSeq Services
    • >
      TubeSeq Labels & Coupons
    • >
      PlateSeq Service
    • >
      PlateSeq Kits
    • >
      Direct Colony Sequencing
    • >
      Whole Plasmid Sequencing
    • >

      LightRun Services

    • >
      LightRun Barcodes
    • >
      GATC Services
    • >

      Zusätzliche Services

    • >
      Tube & Platten Barcode Labels
    • >
      Sequenzier-Primer
    • >
      Sequenzier-Accessories
    • >
      Probenversand
    • >
      Kostenlose Probenabholung
  • Next Generation Sequencing
    • >

      NGS Built For You

    • >
      INVIEW Microbiome
    • >
      INVIEW Metagenome
    • >
      INVIEW Transcriptome
    • >
      INVIEW Exome
    • >
      INVIEW CRISPR Check
    • >
      INVIEW Virus
    • >
      NGS Prepaid Coupons
    • >
      INVIEW Plasmid Verification
    • >

      NGS Build Your Own

    • >
      NGSelect DNA
    • >
      NGSelect RNA
    • >
      NGSelect Amplikon
    • >
      NGSelect Ready2Load
    • >

      NGS Projekte

    • >
      Genom-Sequenzierung
    • >

      Anwendungen

    • >
      Onkologie Lösungen
  • Gensynthese & Molekularbiologie
    • >

      Gensynthese

    • >
      Standard Gene
    • >
      Express Gene
    • >
      Komplexe Gene
    • >
      Genbibliotheken
    • >
      GeneStrands
    • >
      Express GeneStrands
    • >
      Gene im neuen Shop
    • >

      GENEius

    • >
      Sequenzoptimierung
    • >
      Codon Usage Anpassung
    • >
      GENEius Und Ecom
    • >

      Molekularbiologische Services

    • >
      Plasmid Präparation
    • >
      Ortsgerichtete Mutagenese
    • >

      Anwendungen

    • >
      CRISPR/Cas9
  • Genotypisierung & Genexpression
    • >

      Service Plattformen

    • >
      Illumina Array Plattformen
    • >
      Affymetrix Array Plattformen
    • >
      Fluidigm BioMark & EP1
    • >
      Roche LightCycler
    • >
      Sanger Sequenzierung & NGS
    • >

      Genotypisierung Services

    • >
      SNP Genotypisierung
    • >
      Mikrosatelliten / STR / FLA / IDAA
    • >
      Mittels Sequenzierung
    • >
      Genotypisierung mittels PCR
    • >
      Genom-weite Assoziationen
    • >
      Humanidentifizierung
    • >
      Copy Number Variation
    • >

      Genexpression Services

    • >
      Transkriptomanalyse
    • >
      Expressionsarrays
    • >
      Target Gene Expression
    • >
      miRNA / small RNA Analyse
    • >

      Applied Genomics Services

    • >
      Residual DNA Nachweis
    • >
      DNA Barcoding
    • >
      Zelllinienauthentifizierung
    • >
      Mycoplasmacheck
 

NGSgrade 2nd PCR Oligos

  Intro & Info

The Amplicon 2nd PCR Oligos have been developed especially to allow pooling of samples for NGS on Illumina

They are designed and validated by our in-house NextGen sequencing lab.

How it works
  • You provide amplicons generated with NGS primers consisting of the target specific sequences and a universal adapter sequence
  • During library prep, Eurofins Genomics adds indexed sequencing adaptors necessary for sample discrimination

How to order
  • Please download our Excel template first, which is specifically coded for designing your 2nd PCR primers
  • Each PCR product must harbor universal adaptors on both ends of the fragment
  • We are directly adding the required adaptor sequences to the target specific primer sequences you are uploading
  • For a correct design, you must provide those sequences in 5’ -3’ direction
  • You may provide in the upload form different forward and reverse primers in case you are targeting more than one region
  • Upload the filled Excel form and press "Next". Options for synthesis scales and delivery format are found in the next step
  • Check your uploaded sequences on the next step and press "Add to Cart"

Adaptor sequences
  • Forward Primer Sequence: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
  • Reverse Primer Sequence: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT

 
  • Select your entry format
  • Specify your oligos
 

Entry Format

XLS Icon Download our Excel template for uploading your NGS Oligos.
Please read more details in above INTRO & INFO box by clicking on the arrow icon.
 
 
 
Define your oligos by using our Excel template above. Upload your file and press "Next".
 
 
Next
 
Production Site
  • Europe
  • America
  • India
  • Japan
Eurofins Genomics
  • Terms & Conditions
  • Sitemap
  • Imprint
  • Privacy
  • Licenses
  • Cookie Settings
Contact
General Customer Support
phone +49 7531 816068
Toll free phone number for
Europe: 00800 200 100 20
support-eu@genomics.eurofinseu.com

Eurofins Genomics Europe Shared Services GmbH
Anzinger Str. 7a
85560 Ebersberg
Germany

/p>

2025 - Eurofins Genomics

VEGA Beta