INVIEW Microbiome Profiling                                            
progress bar
progress bar

eurofins eurofins

Email
Password
 
  
Forgot Password?
Create Account
 
 
  • Quick Order
  • 0

    Cart

  • Account
    • Login
    • Create Account
  • Products & Services
    • Oligonucleotide Synthesis
      • Products & Services
      • Oligonucleotide Synthesis
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Helpful Links
        • Oligo Decision Tree
        • Oligo Excel Upload Forms

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Optimisation tool
        • GENEius
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • IVT mRNA
        • Special Requests
        • Custom Projects
        • Helpful Links
        • FAQs Gene Synthesis / Molecular Biology
        • Gene Synthesis Deal
        • Plasmid Preparation
          High-quality DNA for reliable results. From 15µg up to 20mg.

          Order Now

           

    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Standard Sanger Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Services For Premixed Samples
        • Mix2Seq
        • LightRun Services
        • Special Sequencing Services
        • Direct Colony Sequencing
        • Sequence Verification and Primer Walking (ISO 17025/GLP)
        • Sample Submission Options
        • Free Sample Pick-Up
        • Sample Shipment
        • Test Our Services for Free
        • Request a Free Test
        • Helpful Links
        • FAQs Sanger Sequencing
        • Sequencing Primers
        • Sequencing Result Guide
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio - Products
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Bacteria Assembly Hybrid
        • Yeast Genome Sequencing
        • ONT Lite - Additional Services
        • Prepaid ONT Coupons
        • Free barcodes
        • ONT Lite Assembly Review
        • Genome Sequencing (Full Flow Cells)
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing (Full Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Short-read WGS
        • Long-read WGS
        • Low-pass WGS
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Metabarcoding
        • Skin Microbiome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Single Cell RNA Sequencing
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Request for Information
        • Special applications
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • 16S qPCR Sanger
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
        • Species determination
        • Meat determination
        • Plant determination
        • Fish determination
        • Direct order pages for species determination
          Accurately identify meat / plant / fish species and verify authenticity

          Meat testing

          Plant testing

          Fish testing

  • Markets
    • All Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Overview
        • Pharma Portfolio
        • Oncology Portfolio
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Overview
        • Agrigenomics Portfolio
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Overview
        • Consumer Genomics Portfolio
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Overview
        • Food & Environment Portfolio
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
        • Order pages for species determination
        • Meat species determination
        • Plant species determination
        • Fish species determination
        •  

          Fish determination & authenticity testing
          High-resolution genetic analysis for seafood products

          Learn more

           

        •  

          Meat determination & authenticity testing
          Accurately identify animal species and verify meat authenticity

          Learn more

           

           

           

        •  

          Plant differentiation & authenticity testing
          High-resolution genetic analysis for plant-based products

          Learn more

           

    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Overview
        • Kit Producer Portfolio
        • Synthesis Products
        • Large Scale Oligos
        • Special Oligo Requests
        • Gene Synthesis Projects
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Overview
        • Research Portfolio
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
        • GATCViewer
    • Tools
      • Resources
      • Tools
        • Design tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
    • Help Center
      • Resources
      • Help Center
        • NGS Sample Submission
        • How to submit my NGS samples
        • How to find my nearest Dropbox location
        • How to order NGS barcodes
        • How to send NGS replacement samples
        • How to order a UPS label for NGS sample shipment
        • NGS Quotes
        • How to request an NGS quote or place an NGS order
        • How to accept an NGS Quote
        • Order tracking & data access
        • How to manage my orders
        • How to track the status of my NGS sample
        • How to access my NGS data
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Events
        • Holiday Hours
        • Imprint
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
        • Test our Services for Free
        • Gene Synthesis Deal
  • Contact
Logo
  • Products & Services
    • Oligonucleotide Synthesis
      • Products & Services
      • Oligonucleotide Synthesis
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Helpful Links
        • Oligo Decision Tree
        • Oligo Excel Upload Forms

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Optimisation tool
        • GENEius
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • IVT mRNA
        • Special Requests
        • Custom Projects
        • Helpful Links
        • FAQs Gene Synthesis / Molecular Biology
        • Gene Synthesis Deal
        • Plasmid Preparation
          High-quality DNA for reliable results. From 15µg up to 20mg.

          Order Now

           

    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Standard Sanger Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Services For Premixed Samples
        • Mix2Seq
        • LightRun Services
        • Special Sequencing Services
        • Direct Colony Sequencing
        • Sequence Verification and Primer Walking (ISO 17025/GLP)
        • Sample Submission Options
        • Free Sample Pick-Up
        • Sample Shipment
        • Test Our Services for Free
        • Request a Free Test
        • Helpful Links
        • FAQs Sanger Sequencing
        • Sequencing Primers
        • Sequencing Result Guide
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio - Products
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Bacteria Assembly Hybrid
        • Yeast Genome Sequencing
        • ONT Lite - Additional Services
        • Prepaid ONT Coupons
        • Free barcodes
        • ONT Lite Assembly Review
        • Genome Sequencing (Full Flow Cells)
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing (Full Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Short-read WGS
        • Long-read WGS
        • Low-pass WGS
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Metabarcoding
        • Skin Microbiome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Single Cell RNA Sequencing
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Request for Information
        • Special applications
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • 16S qPCR Sanger
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
        • Species determination
        • Meat determination
        • Plant determination
        • Fish determination
        • Direct order pages for species determination
          Accurately identify meat / plant / fish species and verify authenticity

          Meat testing

          Plant testing

          Fish testing

  • Markets
    • All Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Overview
        • Pharma Portfolio
        • Oncology Portfolio
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Overview
        • Agrigenomics Portfolio
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Overview
        • Consumer Genomics Portfolio
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Overview
        • Food & Environment Portfolio
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
        • Order pages for species determination
        • Meat species determination
        • Plant species determination
        • Fish species determination
        •  

          Fish determination & authenticity testing
          High-resolution genetic analysis for seafood products

          Learn more

           

        •  

          Meat determination & authenticity testing
          Accurately identify animal species and verify meat authenticity

          Learn more

           

           

           

        •  

          Plant differentiation & authenticity testing
          High-resolution genetic analysis for plant-based products

          Learn more

           

    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Overview
        • Kit Producer Portfolio
        • Synthesis Products
        • Large Scale Oligos
        • Special Oligo Requests
        • Gene Synthesis Projects
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Overview
        • Research Portfolio
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
        • GATCViewer
    • Tools
      • Resources
      • Tools
        • Design tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
    • Help Center
      • Resources
      • Help Center
        • NGS Sample Submission
        • How to submit my NGS samples
        • How to find my nearest Dropbox location
        • How to order NGS barcodes
        • How to send NGS replacement samples
        • How to order a UPS label for NGS sample shipment
        • NGS Quotes
        • How to request an NGS quote or place an NGS order
        • How to accept an NGS Quote
        • Order tracking & data access
        • How to manage my orders
        • How to track the status of my NGS sample
        • How to access my NGS data
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Events
        • Holiday Hours
        • Imprint
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
        • Test our Services for Free
        • Gene Synthesis Deal
  • Contact
Login | Create Account

INVIEW Microbiome Profiling

  • You are here:
  • Next Generation Sequencing >
  • NGS Built For You >
  • INVIEW Microbiome

 

 

INVIEW Microbiome profiling using short reads

Our INVIEW Microbiome Profiling provides highly sensitive identification and classification of bacteria, funghi and archaea including 16S, 18S, ITS studies, as well as population analyses across various environmental, food, and clinical samples. 

 

Eurofins Genomics amplifies and sequences <570 bp of the hypervariable regions of the 16S and 18S rRNA genes and the fungal internal transcribed spacer (ITS) gene. If your target isn’t covered by established primer sets, we offer a custom target implementation service to meet your needs. 

 

Choose our standard option, which provides approximately 20,000 reads per sample (no guarantee), or upgrade to our premium packages with guaranteed 60,000 reads for enhanced data quality at competitive prices. 

 

For 16S full-length sequencing, please utilize our new long-read V1V9 16S sequencing service here. 

 

If you prepare your own 16S, 18S or ITS amplicons, we recommend utilizing our short- and long-read amplicon sequencing services.

 

 

 

 

>> Get Quote / Order

>> Order Barcodes

>> Redeem NGS Coupons

 

 

 

Highlights

 

  • No sample number limitation
  • Ultra-low price for more than 192 samples per batch
  • Generation of 1 to 4 amplicons per DNA sample (choose from our target list)
  • Illumina sequencing with 2 x 300 bp paired-end read module
  • Services are performed in ISO17025 certified labs
  • Comprehensive bioinformatics service & interactive analysis reports
  • Data transfer via secure FTP

Application & services

 

  • We provide optional bioinformatics for trimming and merging of overlapping paired reads or comprehensive 16S microbiome profiling with taxon identification. 
  • For optional DNA isolation service, please refer to our DNA isolation guide. 

 

We do not accept samples with higher biosafety level than S2. GMOs are only accepted with S1 level. 

 

 

>> FAQ's Microbiome

>> NGS Prepaid Coupons

>> Sample Submission

>> ONT 16S Full Length SEQ

 

 

 

Product Specifications & Ordering

 

  

Specifications
Premium - 60k read pairs
Standard - 20k read pairs
High-throughput - 20k read pairs
Number of samples From 1 sample From 12 samples From 184 samples (with extraction)
From 188 samples (w/o ex)
Run mode 2 x 300 bp 2 x 300 bp 2 x 300 bp
Read amount 60k read pairs 20k read pairs (add-on reads possible) 20k read pairs (add-on reads possible)
Guaranteed reads Yes No No
Target selection Standard & non-standard targets Standard & non-standard targets Standard & non-standard targets
Trimming & merging of overlapping reads Optional Optional Included
Microbial community profiling Optional Optional Optional

 

 

 

Specifications

  • Generation of 1 – 4 amplicons per DNA sample (you can choose from our target list)
  • Quality control assessment after target specific amplification
  • Pooling & normalisation of amplicons
  • Sequencing on Illumina´s MiSeq with the 2 x 300 bp paired-end read module
  • Delivery of on average 20,000 read pairs or guaranteed 60,000 read pairs per amplicon (+/- 3%)
  • For the products with 20,000 read pairs, you can order additional multiples of 10,000 read pairs if required.

 

 

Starting material

  • Sample Type: Purified DNA
  • Purity (OD260/280): 1.8-2.0
  • Volume: 1 target: 20µL for each additional target plus 10 µL (e.g. 50 µL for 4 targets)
  • Concentration: 10-50 ng/µL
  • Minimum Amount: 200 ng
  • Resuspension Buffer Water, EB, or low TE (<0.1 mM EDTA)
  • Format: barcode labelled tubes or plates
  • Shipment Method: Room temperature/ice

 

Tube format: 1.5 ml safe-lock tubes

 

Plate format: Eppendorf twin.tec PCR Plate 96, semi-skirted, leave position G12 & H12 empty

Standard targets

If your target isn’t covered by our established standard and non-standard primer sets, we offer a custom target implementation service to meet your needs.

Organism Gene Region Primer Name Amplicon Length (bp) Primer Sequence Orientation Reference
Bacteria 16S V1-V3 27F 500 AGAGTTTGATCATGGCTCAG F Weisburg et al., 1991
530R GTATTACCGCGGCTGCTG R Leser T.D. et al., 2002
Bacteria 16S V3-V4 347F 430  TACGGGAGGCAGCAG F Turner et al., 1999
800R CCAGGGTATCTAATCC R Kisand et al., 2002
Bacteria 16S V3-V5 341F 570  CCTACGGGNGGCWGCAG F Herlemann et al., 2011
926R CCGYCAATTYMTTTRAGTTT R Quince et al., 2011, EMP
Archaea 16S V3-V4 340F 450  CCCTAYGGGGYGCASCAG F Gantner et al. 2011
806R GGACTACNVGGGTWTCTAAT R Apprill et al., 2015
Fungi ITS1    ITS5F 100-1000*  GGAAGTAAAAGTCGTAACAAGG F White et al., 1990
ITS2R GCTGCGTTCTTCATCGATGC R White et al., 1990
Fungi ITS2    ITSbF 100-800*  GCATCGATGAAGAACGCAGC F White et al., 1990
ITSbR TCCTCCGCTTATTGATATGC R White et al., 1990

 

* The length of the ITS region in fungi can vary significantly depending on the specific species.

 

Additional non-standard targets available

 

 

 

Organism Gene Region Primer Name Amplicon Length (bp) Primer Sequence Orientation Reference
Bacteria 16S V4 515F 270

GTGYCAGCMGCCGCGGTAA F Parada et al., 2016
806R GGACTACNVGGGTWTCTAAT R Apprill et al., 2015
Bacteria 16S V1-V3 27F 500  AGRGTTYGATYMTGGCTCAG F Walker et al., 2015
534R ATTACCGCGGCTGCTGG R Muyzer et al., 1993
Bacteria 16S V3-V4 341F 450  CCTACGGGNGGCWGCAG F Herlemann et al., 2011
806R GGACTACNVGGGTWTCTAAT R Apprill et al., 2015
Bacteria 16S V3-V4 341F 450  CCTACGGGNGGCWGCAG F Herlemann et al., 2011
805R GACTACHVGGGTATCTAATCC R Nalashenkov et al., 2021
Fungi 18S    FungiF1_F 340*  GTGGTAATTCTAGAGCTAATACATGCT F in-house developed
FungiF1_R CCTGTATCAGTATTTATTGTCACTAC R in-house developed
Fungi ITS1    ITS1F 100-1000*  TCCGTAGGTGAACCTGCGG F White et al., 1990
ITS2R GCTGCGTTCTTCATCGATGC R White et al., 1990
Fungi ITS2   fITS7F 100-800* GTGARTCATCGAATCTTTG F Ihrmark et al, 2012
ITSbR TCCTCCGCTTATTGATATGC R White et al. 1990

 

 

* The length of the ITS region in fungi can vary significantly depending on the specific species.

Deliverables

  • Raw data FASTQ files
  • Optional trimmed and merged FASTQ files
  • Optional analysis for comprehensive microbiome profiling:
    • Comprehensive interactive profiling report (.HTML)
    • Taxonomy tables (.TXT)
    • OTU tables, including normalized abundance estimation (.TXT, .BIOM)
    • Read sequences of OTU representatives (.FASTA)
    • Processed reads sequences that went into the OTU picking process (.FASTA) Taxonomy plots
    • View our Microbiome Analysis report below

 

 

 

Literature

 

INVIEW Microbiome Demo Report

The demo PDF report, but your final report will be in interactive HTML format.

Press Release: Accredited NGS Tests for Identification of Non-Targeted Microorganism

 

 

 

 

 

 

 

 

Solutions you may also like

 

 

 

INVIEW Metagenome


Deep insights into the microbiota of your sample


>> READ MORE

 

 

 

NGS Coupons


The perfect prepaid solution for your NGS projects


>> READ MORE

 

 

 

NGSgrade Oligos


Validated by our NextGen sequencing lab


>> READ MORE

 

 

 

16S Full-Length


Oxford Nanopore sequencing to gain total insights


>> READ MORE

 

 

Quality is important for us at Eurofins

Our products and services are produced and performed under strict quality management and quality assurance systems.

Find certificates here

Quality is important for us

Our products and services are produced and performed under strict quality management and quality assurance systems.

Find certificates here
Contact Us

TECHNICAL SUPPORT

Phone:

Mon-Fri:

Toll Free Phone Number:

E-Mail:

DETAILS

+49 (8092) 3379800
8 : 00 AM – 2 : 00 PM, ET
00800-200 100 20
support-eu@genomics.eurofinseu.com

QUOTES, PRICING & SPECIAL REQUESTS

Quotes are submitted, reviewed, and accepted through the online quoting tool. Learn more.
Please direct inquires about pricing and special project requests to your sales representative.
General questions: support-eu@genomics.eurofinseu.com

Change Region

  • Europe (current website)
  • America
  • India
  • Japan

We love hearing from our customers. Feel free to leave feedback.

Submit Feedback
Careers
  • ISO 9001
  • ISO 13485
  • ISO 17025

2026 - Copyright Eurofins Genomics

  • Terms & Conditions
  • Corporate
  • Privacy
  • Imprint
VEGA Beta