High quality oligonucleotides with excellent performance in industrial NGS applications. - Index Adaptor Primers for incorporation of molecular barcodes (UDIs, CDIs, UDI-UMIs)
- Primers for amplification and sequencing
- Target Capture Probes or blocking oligos
- Other molecular biological applications with low cross-contamination specifications
Specifications:- Typical cross contamination rate of 0.01% - 0.05%
- Available minimum quantities of 4 nmol, 10 nmol and 25 nmol
- DNA sequence length from 15 - 120 bases
- Quality is ensured by ESI-MS (electrospray ionization mass spectrometry)
- A quality report including the ESI-MS spectra is provided online, free of charge
- Oligos are supplied in tubes either lyophilized or in liquid form at the selected concentration
- Selectable solvents are bidest water, TE buffer (10 mM Tris, 1 mM EDTA; pH=8) or Low EDTA Puffer (10 mM Tris, 0.1 mM EDTA pH = 8)
- Additional services such as custom normalization, mixing or pooling, verification of quality by NGS are available upon request
If you need a tube label with a barcode you have defined for use in your LIMS system, enter the barcode numbers under
"Customer barcode". Use our
Oligo Analysis Tool to check if these primer sequences forms self-dimers before ordering.
How to order: We recommend using our Excel template to upload your NGS oligos, where
oligo name,
sequence and
customer barcode can be specified per oligo.
Sequence info: ACGT = DNA;
A*C*G*T = PTO ;
I = 2’-Desoxyinosine; U = 2’-Desoxyuridine; [PHO] = Phosphate modification Example: [PHO]TACGCGTACTTCTGTAGCGCTA
UATCGAGTACGTCGCAGCTCGAC
IAGCTCGTACUGAC*G
Use the
IUB code for wobble bases (equal amount of degenerated based)
You can also use the bubble icon to add a
personal note to an oligo. Check your entries and click on "Add to cart".
Special requests:Additional services can be requested via a bespoke offer. Simply click on "Request a quote" and describe your needs in the production comment. Our experts will create the right offer for you, which can be accepted online.