Custom DNA Oligos in Platte                                            
progress bar
progress bar

eurofins eurofins

Email
Password
 
  
Forgot Password?
Create Account
 
 
  • Quick Order
  • 0

    Cart

  • Account
    • Login
    • Create Account
  • Produkte & Services
    • Oligonukleotid-Synthese
      • Produkte & Services
      • Oligonukleotid-Synthese
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Spezialanfragen
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Hilfreiche Links
        • Oligo Decision Tree
        • Excel Upload Formulare Oligos

        • Prepaid Oligo Coupons
          Eine einzigartige Vorauszahlungsoption für PCR- und Sequenzier-Primer
          Mehr Erfahren

           

           

    • Gensynthese & Molekularbiologie
      • Produkte & Services
      • Gensynthese & Molekularbiologie
        • Synthetische Gene
        • Standard Gene
        • Express Gene
        • Complex Genes
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Optimierungs-Tool
        • GENEius
        • Molekular Biologische Services
        • Plasmid Präparation
        • Ortsgerichtete Mutagenese (SDM)
        • DNA Klonierung
        • IVT mRNA
        • Spezielle Anfragen
        • Individuelle Projekte
        • Hilfreiche Links
        • FAQs Gensynthese / Molekularbiologie
        • Gensynthese Angebot
        • Plasmid Präparation
          Hochwertige DNA für zuverlässige Ergebnisse. Von 15µg bis zu 20mg.

          Jetzt bestellen

           

           

    • Sanger Sequenzierung
      • Produkte & Services
      • Sanger Sequenzierung
        • Standard Sanger Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Services Für Premixed Proben
        • Mix2Seq
        • LightRun Services
        • Spezielle Sequenzier-Services
        • Direct Colony Sequencing
        • Sequenzverifizierung und Primer Walking (ISO 17025/GLP)
        • Versandoptionen
        • Kostenlose Probenabholung
        • Probenversand
        • Service kostenlos testen
        • Kostenlosen Test Erhalten
        • Hilfreiche Links
        • FAQs Sanger Sequenzierung
        • Sequenzier-Primer
        • Sequencing Result Guide
        • Mix2Seq Kit
          Schnellste Sanger-Sequenzierung von Premixed Proben in Tubes.

          Jetzt bestellen

           

           

    • Nanopore Sequenzierung
      • Produkte & Services
      • Nanopore Sequenzierung
        • ONT Lite Portfolio - Produkte
        • Whole Plasmid Sequencing
        • Klonale Amplikonsequenzierung
        • Genomsequenzierung von Bakterien
        • Genomsequenzierung von Hefen
        • Hybrid-Assemblierung von Bakterien
        • ONT Lite - Zusätzliche Services
        • Prepaid ONT Coupons
        • Kostenlose Barodes
        • ONT Lite Assembly Review
        • Genom-Sequenzierung (Projekte - ganze Flow Cells)
        • Human-Genomsequenzierung
        • Bakterien-Genomsequenzierung
        • Whole Genome Sequencing Non-Human
        • Amplikon-Sequenzierung (Projekte - ganze Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Volllängen-Mikrobiom
        • Prepaid ONT Lite Coupons
          Eine einzigartige "Pre-Payment"-Methode für Ihre Oxford Nanopore Sequenzierung

          Mehr erfahren

           

           

    • Next Generation Sequencing
      • Produkte & Services
      • Next Generation Sequencing
        • Genom-Sequenzierung
        • Short-read WGS
        • Long-read WGS
        • INVIEW Resequencing
        • Mikrobiom & Metagenom
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung – Komplettservice
        • Transkriptom-Sequenzierung
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatische Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Wichtige Informationen
        • Probenvorbereitung - Versand
        • Publikationen
        • Spezielle Anwendungen
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons
          Eine einzigartige Vorauszahlungsoption für unsere NGS Services
          Mehr erfahren

           

           

    • Genotypisierung & Genexpression
      • Produkte & Services
      • Genotypisierung & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Zelllinienauthentifizierung
        • Mycoplasmacheck
        • Fragmentlängen-Analyse
        • Genotyping Services
        • SNP Genotypisierung
        • Copy Number Variation
        • Mikrosatellites/ STR/ FLA/ IDAA
        • Genexpression Services
        • Transkriptomanalyse
        • Expressionsarrays
        • Target Gene Expression
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

  • Märkte
    • Alle Märkte
    • Pharma / Biotech
      • Märkte
      • Pharma / Biotech
        • Syntheseprodukte
        • Industrie-optimierte NGS Oligos
        • Ultimate Precision Probes
        • Spezielle Oligo Anfragen
        • Large-Scale Oligos
        • Gensynthese
        • GeneStrands
        • Sequenzier-Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Interessante Artikel (En)
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Märkte
      • Agrigenomics
        • Pflanzenzüchter
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Tierzüchter
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Interessante Artikel (En)
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
    • Consumer Genomics
      • Märkte
      • Consumer Genomics
        • Sequenzierung Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Ergänzende Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Interessante Artikel (En)
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Nahrungsmittel und Umwelt
      • Märkte
      • Nahrungsmittel und Umwelt
        • Lebensmittel-Tests
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Umwelt-Tests
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Interessante Artikel (En)
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

    • Diagnostik Kit Produzenten
      • Märkte
      • Diagnostik Kit Produzenten
        • Syntheseprodukte
        • Large-Scale Oligos
        • Spezialanfragen für Oligos
        • Gensynthese Projekte
        • Qualitätssicherung
        • GLP
        • ISO 17025
        • ISO 13485
        • Interessante Artikel (En)
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Forschung / Biotech
      • Märkte
      • Forschung / Biotech
        • Beliebte Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Interessante Artikel (En)
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Infos & Tools
    • Account
      • Infos & Tools
      • Account
        • Mein Profil
        • Bestellungen
        • Angebote
        • Gruppen
        • Einstellungen
        • Adressen
        • Dropboxen in der Nähe
        • Barcode Management
        • Sanger Kits & Barcodes
        • NGS Barcodes & Coupons
        • Genotyping Barcodes
        • Oligo Coupons
        • Primer / Cell Line Management
        • Sanger Proben & Primer
        • Zelllinien Management
    • Bezahloptionen
      • Infos & Tools
      • Bezahloptionen
        • EVOCARD Optionen
        • EVOcard Bezahlung
        • Neubestellung oder Aufladung EVOcard
    • Hilfe
      • Infos & Tools
      • Hilfe
        • Produkt FAQs
        • Video Anleitungen
        • GENEius
        • Excel Upload Formulare Oligos
        • Oligo Decision Tree
        • GATCViewer
    • Tools
      • Infos & Tools
      • Tools
        • Design Tools
        • Oligo Analyse Tool
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
    • Hilfe Center
      • Infos & Tools
      • Hilfe Center
        • NGS Probenversand
        • Wie sende ich meine NGS‑Proben ein?
        • Wie finde ich die nächstgelegene Dropbox‑Station?
        • Wie bestelle ich NGS‑Barcodes?
        • Wie sende ich Ersatzproben für NGS ein?
        • Wie bestelle ich ein UPS‑Label für den Versand meiner NGS‑Proben?
        • NGS Angebote
        • Wie fordere ich ein NGS‑Angebot an?
        • Wie akzeptiere ich ein NGS‑Angebot?
        • Bestellungen & Daten
        • Wie verwalte ich meine Bestellungen?
        • Wie verfolge ich den Status meiner NGS‑Probe
        • Wie greife ich auf meine NGS‑Daten zu
  • Über uns
    • Über uns
      • Über uns
      • Über uns
        • Über Eurofins
        • Karriere
        • Distributoren
        • Neuigkeiten
        • Schließzeiten der Labore
        • Events
        • Impressum
    • Qualitätssicherung
      • Über uns
      • Qualitätssicherung
        • Qualitätssicherung
    • Angebote und Aktionen
      • Über uns
      • Angebote und Aktionen
        • Alle Angebote und Aktionen
        • Services Kostenlos Testen
        • Gensynthese-Angebot
  • Kontakt
Logo
  • Produkte & Services
    • Oligonukleotid-Synthese
      • Produkte & Services
      • Oligonukleotid-Synthese
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Spezialanfragen
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Hilfreiche Links
        • Oligo Decision Tree
        • Excel Upload Formulare Oligos

        • Prepaid Oligo Coupons
          Eine einzigartige Vorauszahlungsoption für PCR- und Sequenzier-Primer
          Mehr Erfahren

           

           

    • Gensynthese & Molekularbiologie
      • Produkte & Services
      • Gensynthese & Molekularbiologie
        • Synthetische Gene
        • Standard Gene
        • Express Gene
        • Complex Genes
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Optimierungs-Tool
        • GENEius
        • Molekular Biologische Services
        • Plasmid Präparation
        • Ortsgerichtete Mutagenese (SDM)
        • DNA Klonierung
        • IVT mRNA
        • Spezielle Anfragen
        • Individuelle Projekte
        • Hilfreiche Links
        • FAQs Gensynthese / Molekularbiologie
        • Gensynthese Angebot
        • Plasmid Präparation
          Hochwertige DNA für zuverlässige Ergebnisse. Von 15µg bis zu 20mg.

          Jetzt bestellen

           

           

    • Sanger Sequenzierung
      • Produkte & Services
      • Sanger Sequenzierung
        • Standard Sanger Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Services Für Premixed Proben
        • Mix2Seq
        • LightRun Services
        • Spezielle Sequenzier-Services
        • Direct Colony Sequencing
        • Sequenzverifizierung und Primer Walking (ISO 17025/GLP)
        • Versandoptionen
        • Kostenlose Probenabholung
        • Probenversand
        • Service kostenlos testen
        • Kostenlosen Test Erhalten
        • Hilfreiche Links
        • FAQs Sanger Sequenzierung
        • Sequenzier-Primer
        • Sequencing Result Guide
        • Mix2Seq Kit
          Schnellste Sanger-Sequenzierung von Premixed Proben in Tubes.

          Jetzt bestellen

           

           

    • Nanopore Sequenzierung
      • Produkte & Services
      • Nanopore Sequenzierung
        • ONT Lite Portfolio - Produkte
        • Whole Plasmid Sequencing
        • Klonale Amplikonsequenzierung
        • Genomsequenzierung von Bakterien
        • Genomsequenzierung von Hefen
        • Hybrid-Assemblierung von Bakterien
        • ONT Lite - Zusätzliche Services
        • Prepaid ONT Coupons
        • Kostenlose Barodes
        • ONT Lite Assembly Review
        • Genom-Sequenzierung (Projekte - ganze Flow Cells)
        • Human-Genomsequenzierung
        • Bakterien-Genomsequenzierung
        • Whole Genome Sequencing Non-Human
        • Amplikon-Sequenzierung (Projekte - ganze Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Volllängen-Mikrobiom
        • Prepaid ONT Lite Coupons
          Eine einzigartige "Pre-Payment"-Methode für Ihre Oxford Nanopore Sequenzierung

          Mehr erfahren

           

           

    • Next Generation Sequencing
      • Produkte & Services
      • Next Generation Sequencing
        • Genom-Sequenzierung
        • Short-read WGS
        • Long-read WGS
        • INVIEW Resequencing
        • Mikrobiom & Metagenom
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung – Komplettservice
        • Transkriptom-Sequenzierung
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatische Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Wichtige Informationen
        • Probenvorbereitung - Versand
        • Publikationen
        • Spezielle Anwendungen
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons
          Eine einzigartige Vorauszahlungsoption für unsere NGS Services
          Mehr erfahren

           

           

    • Genotypisierung & Genexpression
      • Produkte & Services
      • Genotypisierung & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Zelllinienauthentifizierung
        • Mycoplasmacheck
        • Fragmentlängen-Analyse
        • Genotyping Services
        • SNP Genotypisierung
        • Copy Number Variation
        • Mikrosatellites/ STR/ FLA/ IDAA
        • Genexpression Services
        • Transkriptomanalyse
        • Expressionsarrays
        • Target Gene Expression
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

  • Märkte
    • Alle Märkte
    • Pharma / Biotech
      • Märkte
      • Pharma / Biotech
        • Syntheseprodukte
        • Industrie-optimierte NGS Oligos
        • Ultimate Precision Probes
        • Spezielle Oligo Anfragen
        • Large-Scale Oligos
        • Gensynthese
        • GeneStrands
        • Sequenzier-Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Interessante Artikel (En)
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Märkte
      • Agrigenomics
        • Pflanzenzüchter
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Tierzüchter
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Interessante Artikel (En)
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
    • Consumer Genomics
      • Märkte
      • Consumer Genomics
        • Sequenzierung Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Ergänzende Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Interessante Artikel (En)
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Nahrungsmittel und Umwelt
      • Märkte
      • Nahrungsmittel und Umwelt
        • Lebensmittel-Tests
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Umwelt-Tests
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Interessante Artikel (En)
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

    • Diagnostik Kit Produzenten
      • Märkte
      • Diagnostik Kit Produzenten
        • Syntheseprodukte
        • Large-Scale Oligos
        • Spezialanfragen für Oligos
        • Gensynthese Projekte
        • Qualitätssicherung
        • GLP
        • ISO 17025
        • ISO 13485
        • Interessante Artikel (En)
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Forschung / Biotech
      • Märkte
      • Forschung / Biotech
        • Beliebte Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Interessante Artikel (En)
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Infos & Tools
    • Account
      • Infos & Tools
      • Account
        • Mein Profil
        • Bestellungen
        • Angebote
        • Gruppen
        • Einstellungen
        • Adressen
        • Dropboxen in der Nähe
        • Barcode Management
        • Sanger Kits & Barcodes
        • NGS Barcodes & Coupons
        • Genotyping Barcodes
        • Oligo Coupons
        • Primer / Cell Line Management
        • Sanger Proben & Primer
        • Zelllinien Management
    • Bezahloptionen
      • Infos & Tools
      • Bezahloptionen
        • EVOCARD Optionen
        • EVOcard Bezahlung
        • Neubestellung oder Aufladung EVOcard
    • Hilfe
      • Infos & Tools
      • Hilfe
        • Produkt FAQs
        • Video Anleitungen
        • GENEius
        • Excel Upload Formulare Oligos
        • Oligo Decision Tree
        • GATCViewer
    • Tools
      • Infos & Tools
      • Tools
        • Design Tools
        • Oligo Analyse Tool
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
    • Hilfe Center
      • Infos & Tools
      • Hilfe Center
        • NGS Probenversand
        • Wie sende ich meine NGS‑Proben ein?
        • Wie finde ich die nächstgelegene Dropbox‑Station?
        • Wie bestelle ich NGS‑Barcodes?
        • Wie sende ich Ersatzproben für NGS ein?
        • Wie bestelle ich ein UPS‑Label für den Versand meiner NGS‑Proben?
        • NGS Angebote
        • Wie fordere ich ein NGS‑Angebot an?
        • Wie akzeptiere ich ein NGS‑Angebot?
        • Bestellungen & Daten
        • Wie verwalte ich meine Bestellungen?
        • Wie verfolge ich den Status meiner NGS‑Probe
        • Wie greife ich auf meine NGS‑Daten zu
  • Über uns
    • Über uns
      • Über uns
      • Über uns
        • Über Eurofins
        • Karriere
        • Distributoren
        • Neuigkeiten
        • Schließzeiten der Labore
        • Events
        • Impressum
    • Qualitätssicherung
      • Über uns
      • Qualitätssicherung
        • Qualitätssicherung
    • Angebote und Aktionen
      • Über uns
      • Angebote und Aktionen
        • Alle Angebote und Aktionen
        • Services Kostenlos Testen
        • Gensynthese-Angebot
  • Kontakt
Login | Create Account
Header Image
 

Custom DNA Oligos in Platte

  Intro & Info

Select from different purification options, various synthesis scales and delivery formats.
  • Purification options: Salt Free, HPSF, HPLC
  • Synthesis scales from 0.01 to 0.2 µmol
  • Sequence length from 10 - 120 bases
  • Delivered liquid in selected concentration
  • Selectable solvents are bidest water, TE buffer (10 mM Tris, 1 mM EDTA; pH=8) or Low EDTA Puffer (10 mM Tris, 0.1 mM EDTA pH = 8)
  • Minimum 12 oligos per plate are required
Please note:
For probes labelled with Cy3 or Cy5, please order these probes lyophilized or dissolved in water, as they are only stable at pH 7. A higher pH would damage the dye and thus the probe. More information can be found in our Product FAQs.

How to order:

First, select your order entry method below. Use our Excel template for uploading your oligos in plates. Up to 12 plates can be uploaded at a time.

Modifications can be entered directly in the sequence. Sequence info:
ACGT = DNA; A*C*G* = PTO ; I = 2’-Desoxyinosine; U = 2’-Desoxyuridine
Use the IUB code for wobble bases (equal amount of degenerated based)

More options, valid for all plates, are found in the next step, including synthesis scale, delivery format and plate type. You can add a personal note to each plate and rename your plates. After validation you get an overview for each plate. Please specify in the order comment if you need a different plate type for your plate copies.

Check each single plate and finally confirm by pressing "Add to Cart".

Important for mixed plates:
  • Use the same plate names for the forward and reverse primers (e.g. Plate1_ for, Plate1_ rev)
  • Use for both plates the same primer names accompanied by the suffix “.for” or “.f” and “.rev” or ”.r”
  • Select the concentration for the mother plate of the forward primers and reverse primers
  • State in the production comment the final concentration and volume of the primer mix
 
  • Select your entry format
  • Specify your plate(s)
  • Check and confirm
 

Entry Formats

XLS Icon Download our Excel template for uploading your Plate Oligos.
Allowed file formats are xls, xlsx and csv. The file needs three columns named well, oligo name and sequence without a special format.
One plate per sheet can be defined. Up to 12 plates can be uploaded at a time.
 
 
 
Define your plate oligos by using our Excel template above. The name of each plate can be specified in the worksheet. Upload your file and press "Next".
 
 
Oligos for one plate can be pasted in one of the following formats:

well[blank]name1[blank]ACGTACGTACGTACG
well[TAB]name2[TAB]GTA TAG TAG TAG
well, name3, act gct gct gcc
well; name4; [FAM]actgctgaactgctgatgca

ACGT = DNA; A*C*G* T= PTO

Modifications can be included in the DNA sequence at respective position by entering the designator (short name of the modification in square brackets), e.g.: [FAM]actgaa[AmC6dT]ctgga
 
 
Next
 
Contact Us

TECHNICAL SUPPORT

Phone:

Mon-Fri:

Toll Free Phone Number:

E-Mail:

DETAILS

+49 (8092) 3379800
8 : 00 AM – 2 : 00 PM, ET
00800-200 100 20
support-eu@genomics.eurofinseu.com

QUOTES, PRICING & SPECIAL REQUESTS

Quotes are submitted, reviewed, and accepted through the online quoting tool. Learn more.
Please direct inquires about pricing and special project requests to your sales representative.
General questions: support-eu@genomics.eurofinseu.com

Change Region

  • Europe (current website)
  • America
  • India
  • Japan

We love hearing from our customers. Feel free to leave feedback.

Submit Feedback
Careers
  • ISO 9001
  • ISO 13485
  • ISO 17025

2026 - Copyright Eurofins Genomics

  • Terms & Conditions
  • Corporate
  • Privacy
  • Impressum
VEGA Beta